National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6064R-1 
 Symbol TORC  Full Name TORC 
 CG No CG6064  Old CG No CG6064 
 Synonyms dTORC, CG6064, TORC 
 Accession No (Link to NCBI) NM_140744.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCAATCCGCGCAAGTTC 
 Primer Seq. 3'
aatctagaggtaccACCAGCGCACTTTGGTGCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCAATC CGCGCAAGTT CAGCGAGAAG ATCGCTCTGC AGAAGCAGAA GCAGGCGGAG 
0061 GGCACAGCGG AATTCGAGCG GATCATGAAG GAGGTGTATG CCACGAAGAG GGATGAGCCG 
0121 CCTGCGAATC AGAAGATCCT AGACGGCCTT GTCGGCGGTC AGGAGGTAAG CCAATCCTCG 
0181 CCAGGCGCAG GCAATGGGAC GGGCGGAGGT GGCAGTGGTT CCGGCAGTGG AGCCAGCGGC 
0241 GGAGGAGCCT CACCAGATGG CCTGGGAGGC GGCGGTGGTT CTCCGACGGC TTATCGAGAA 
0301 TCCCGAGGGC GCAGCGTAGG TGTGGGTCCC ATGCGAAGAC CGTCGGAGCG CAAGCAGGNA 
0361 TCGTTCGCCC TACGGCAGCA GCAGTACGCA ACAAACCTTA GACAACGGCC AGCTAAATCC 
0421 GCATCTTCTT GGTCCACCTA CGGCGGAGAG TTTGTGGCGG CGGTCCAGCT CCGATTCgGN 
0481 GCTgNACCAA AGTGCGCTGG T 
 in silico PCR Fragment
0001 ATGGCCAATC CGCGCAAGTT CAGCGAGAAG ATCGCTCTGC AGAAGCAGAA GCAGGCGGAG 
0061 GGCACAGCGG AATTCGAGCG GATCATGAAG GAGGTGTATG CCACGAAGAG GGATGAGCCG 
0121 CCTGCGAATC AGAAGATCCT AGACGGCCTT GTCGGCGGTC AGGAGGTAAG CCAATCCTCG 
0181 CCAGGCGCAG GCAATGGGAC GGGCGGAGGT GGCAGTGGTT CCGGCAGTGG AGCCAGCGGC 
0241 GGAGGAGCCT CACCAGATGG CCTGGGAGGC GGCGGTGGTT CTCCGACGGC TTATCGAGAA 
0301 TCCCGAGGGC GCAGCGTAGG TGTGGGTCCC ATGCGAAGAC CGTCGGAGCG CAAGCAGG-A 
0361 TCGTTCGCCC TACGGCAGCA GCAGTACGCA ACAAACCTTA GACAACGGCC AGCTAAATCC 
0421 GCATCTTCTT GGTCCACCTA CGGCGGAGAG TTTGTGGCGG CGGTCCAGCT CCGATTCGGC 
0481 GCTGCACCAA AGTGCGCTGG T 
 Assemble Data

6064R-1.IR_full       1   ATGGCCAATCCGCGCAAGTTCAGCGAGAAGATCGCTCTGCAGAAGCAGAAGCAGGCGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6064R-1.in silico     1   ATGGCCAATCCGCGCAAGTTCAGCGAGAAGATCGCTCTGCAGAAGCAGAAGCAGGCGGAG 60


6064R-1.IR_full       61  GGCACAGCGGAATTCGAGCGGATCATGAAGGAGGTGTATGCCACGAAGAGGGATGAGCCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6064R-1.in silico     61  GGCACAGCGGAATTCGAGCGGATCATGAAGGAGGTGTATGCCACGAAGAGGGATGAGCCG 120


6064R-1.IR_full       121 CCTGCGAATCAGAAGATCCTAGACGGCCTTGTCGGCGGTCAGGAGGTAAGCCAATCCTCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6064R-1.in silico     121 CCTGCGAATCAGAAGATCCTAGACGGCCTTGTCGGCGGTCAGGAGGTAAGCCAATCCTCG 180


6064R-1.IR_full       181 CCAGGCGCAGGCAATGGGACGGGCGGAGGTGGCAGTGGTTCCGGCAGTGGAGCCAGCGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6064R-1.in silico     181 CCAGGCGCAGGCAATGGGACGGGCGGAGGTGGCAGTGGTTCCGGCAGTGGAGCCAGCGGC 240


6064R-1.IR_full       241 GGAGGAGCCTCACCAGATGGCCTGGGAGGCGGCGGTGGTTCTCCGACGGCTTATCGAGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6064R-1.in silico     241 GGAGGAGCCTCACCAGATGGCCTGGGAGGCGGCGGTGGTTCTCCGACGGCTTATCGAGAA 300


6064R-1.IR_full       301 TCCCGAGGGCGCAGCGTAGGTGTGGGTCCCATGCGAAGACCGTCGGAGCGCAAGCAGGNA 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
6064R-1.in silico     301 TCCCGAGGGCGCAGCGTAGGTGTGGGTCCCATGCGAAGACCGTCGGAGCGCAAGCAGG-A 360


6064R-1.IR_full       361 TCGTTCGCCCTACGGCAGCAGCAGTACGCAACAAACCTTAGACAACGGCCAGCTAAATCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6064R-1.in silico     361 TCGTTCGCCCTACGGCAGCAGCAGTACGCAACAAACCTTAGACAACGGCCAGCTAAATCC 420


6064R-1.IR_full       421 GCATCTTCTTGGTCCACCTACGGCGGAGAGTTTGTGGCGGCGGTCCAGCTCCGATTCGGN 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
6064R-1.in silico     421 GCATCTTCTTGGTCCACCTACGGCGGAGAGTTTGTGGCGGCGGTCCAGCTCCGATTCGGC 480


6064R-1.IR_full       481 GCTGNACCAAAGTGCGCTGGT 501
                          |||| ||||||||||||||||
6064R-1.in silico     481 GCTGCACCAAAGTGCGCTGGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140744.1  CG6064-RA (TORC), mRNA 
0.2   NM_079516.2  CG1433-RA (Atu), mRNA 
0.2   NM_170281.1  CG5476-RA (CG5476), mRNA 
0.2   NM_169530.1  CG9412-RC, transcript variant C (rin), mRNA 
0.2   NM_169532.1  CG9412-RE, transcript variant E (rin), mRNA 
0.2   NM_169533.1  CG9412-RA, transcript variant A (rin), mRNA 
0.2   NM_080168.2  CG9412-RB, transcript variant B (rin), mRNA 
0.2   NM_169531.1  CG9412-RD, transcript variant D (rin), mRNA 
0   NM_136674.2  CG1648-RA, transcript variant A (CG1648), mRNA 
0   NM_165696.1  CG1648-RB, transcript variant B (CG1648), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   13  NM_140627.2  CG4784-RA (CG4784), mRNA 
0   12  NM_165468.1  CG8276-RA, transcript variant A (bin3), mRNA 
0   12  NM_078902.2  CG8276-RB, transcript variant B (bin3), mRNA 
0   NM_078774.3  CG13778-RA, transcript variant A (Mnn1), mRNA 
0   NM_001042877.1  CG13778-RC, transcript variant C (Mnn1), mRNA 
0   NM_169806.1  CG31235-RA (CG31235), mRNA 
0   11  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_142844.1  CG7031-RA (CG7031), mRNA 
0   NM_132316.1  CG15370-RA (CG15370), mRNA 
0   NM_132953.1  CG13001-RA (CG13001), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_136862.1  CG8271-RA (CG8271), mRNA 
0   NM_057457.3  CG7109-RA (mts), mRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   NM_141399.1  CG9727-RA (CG9727), mRNA 
0   12  NM_132773.2  CG5627-RA (rab3-GEF), mRNA 
0   NM_205904.1  CG10033-RI, transcript variant I (for), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.