National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6022R-1 
 Symbol Cchl  Full Name Cytochrome c heme lyase 
 CG No CG6022  Old CG No CG6022 
 Synonyms Cchl, CG6022, cchl 
 Accession No (Link to NCBI) NM_142746.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGCAATACAGCCATCACC 
 Primer Seq. 3'
aatctagaggtaccTGAAGCGCCTCCCACTTAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGGCAATA CAGCCATCAC CCCGAGTGCA AATGGAGGCC ACGAAGAGTG TGCCGGTGGA 
0061 CCACGCCAAG TACACGAGCG GCAGTGGTGC CCCGCCACCA GNAATGCCCC ATGCATCAGA 
0121 AGCATGGAGA TGCAAAATCG GCCTCCGCCG TACCCCCACA TCCCAAGATG CAGGCCGCTT 
0181 CCGAATGTCC GGTGCAGCAC GACAACAGCG ACGTTAATCC GCTGAATATG ATGCCACCGG 
0241 CAAACCANAC AGCCGGCGGC AGATCAGCCC TTTCCACTGC CCACCGACCG CCAGACGTCG 
0301 ACCATTCCCA AAGTCACCGA GGATGGCAGC GTTCAATTCT GGCAGTATCC CAGCCAACAG 
0361 ATGTTCTGGA ACGCCATGCT ACGCAAGGGC TGGCGCTGGA AGACCGAGGA CGTATCGCAA 
0421 AAGGACATGG GCGACATCAT ACGCATCCAC AATGCCAACA ACGAGCAGGC CTGGCAGGAG 
0481 GTACTTAAGT GGGAGGCGCT TCA 
 in silico PCR Fragment
0001 ATGGGCAATA CAGCCATCA- CCCGAGTGCA AATGGAGGCC ACGAAGAGTG TGCCGGTGGA 
0061 CCACGCCAAG TACATGAGCG GCAGTGGTGC CCCGCCACCA G-AATGCCCC ATGCATCAGA 
0121 AGCATGGAGA TGCAAAATCG GCCTCCGCCG TACCCCCACA TCCCAAGATG CAGGCCGCTT 
0181 CCGAATGTCC GGTGCAGCAC GACAACAGCG ACGTTAATCC GCTGAATATG ATGCCACCGG 
0241 CAAACCA-AC AGCCGGCGGC AGATCAGCCC TTTCCACTGC CCACCGACCG CCAGACGTCG 
0301 ACCATTCCCA AAGTCACCGA GGATGGCAGC GTTCAATTCT GGCAGTATCC CAGCCAACAG 
0361 ATGTTCTGGA ACGCCATGCT ACGCAAGGGC TGGCGCTGGA AGACCGAGGA CGTATCGCAA 
0421 AAGGACATGG GCGACATCAT ACGCATCCAC AATGCCAACA ACGAGCAGGC CTGGCAGGAG 
0481 GTACTTAAGT GGGAGGCGCT TCA 
 Assemble Data

6022R-1.IR_full       1   ATGGGCAATACAGCCATCACCCCGAGTGCAAATGGAGGCCACGAAGAGTGTGCCGGTGGA 60
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     1   ATGGGCAATACAGCCATCA-CCCGAGTGCAAATGGAGGCCACGAAGAGTGTGCCGGTGGA 60


6022R-1.IR_full       61  CCACGCCAAGTACACGAGCGGCAGTGGTGCCCCGCCACCAGNAATGCCCCATGCATCAGA 120
                          |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||
6022R-1.in silico     61  CCACGCCAAGTACATGAGCGGCAGTGGTGCCCCGCCACCAG-AATGCCCCATGCATCAGA 120


6022R-1.IR_full       121 AGCATGGAGATGCAAAATCGGCCTCCGCCGTACCCCCACATCCCAAGATGCAGGCCGCTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     121 AGCATGGAGATGCAAAATCGGCCTCCGCCGTACCCCCACATCCCAAGATGCAGGCCGCTT 180


6022R-1.IR_full       181 CCGAATGTCCGGTGCAGCACGACAACAGCGACGTTAATCCGCTGAATATGATGCCACCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     181 CCGAATGTCCGGTGCAGCACGACAACAGCGACGTTAATCCGCTGAATATGATGCCACCGG 240


6022R-1.IR_full       241 CAAACCANACAGCCGGCGGCAGATCAGCCCTTTCCACTGCCCACCGACCGCCAGACGTCG 300
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     241 CAAACCA-ACAGCCGGCGGCAGATCAGCCCTTTCCACTGCCCACCGACCGCCAGACGTCG 300


6022R-1.IR_full       301 ACCATTCCCAAAGTCACCGAGGATGGCAGCGTTCAATTCTGGCAGTATCCCAGCCAACAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     301 ACCATTCCCAAAGTCACCGAGGATGGCAGCGTTCAATTCTGGCAGTATCCCAGCCAACAG 360


6022R-1.IR_full       361 ATGTTCTGGAACGCCATGCTACGCAAGGGCTGGCGCTGGAAGACCGAGGACGTATCGCAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     361 ATGTTCTGGAACGCCATGCTACGCAAGGGCTGGCGCTGGAAGACCGAGGACGTATCGCAA 420


6022R-1.IR_full       421 AAGGACATGGGCGACATCATACGCATCCACAATGCCAACAACGAGCAGGCCTGGCAGGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6022R-1.in silico     421 AAGGACATGGGCGACATCATACGCATCCACAATGCCAACAACGAGCAGGCCTGGCAGGAG 480


6022R-1.IR_full       481 GTACTTAAGTGGGAGGCGCTTCA 503
                          |||||||||||||||||||||||
6022R-1.in silico     481 GTACTTAAGTGGGAGGCGCTTCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142746.1  CG6022-RA (CG6022), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_166137.1  CG8405-RA (CG8405), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 
0   NM_206404.1  CG33287-RA (CG33287), mRNA 
0   NM_133145.2  CG8010-RA (CG8010), mRNA 
0   NM_167543.1  CG32574-RA (CG32574), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_057294.4  CG11680-RB, transcript variant B (mle), mRNA 
0   NM_057293.3  CG11680-RA, transcript variant A (mle), mRNA 
0   NM_141174.1  CG12768-RA (CG12768), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_136528.1  CG11635-RA (CG11635), mRNA 
0   NM_057843.2  CG14029-RA, transcript variant A (vri), mRNA 
0   NM_164639.1  CG14029-RC, transcript variant C (vri), mRNA 
0   13  NM_080253.2  CG5067-RA (cic), mRNA 
0   12  NM_078836.2  CG12403-RA (Vha68-1), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_142871.1  CG4624-RA (CG4624), mRNA 
0   NM_136636.3  CG13739-RA (CG13739), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   13  NM_137624.1  CG9090-RA (CG9090), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
VM
VB
 
Caspase-3 signal
N
 
DB
DC
DM
++ 
VM
++ 
VB
 
Dcompartment   Penetrance
++   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.