National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6015R-2 
 Symbol CG6015  Full Name CG6015 
 CG No CG6015  Old CG No CG6015 
 Synonyms CG6015 
 Accession No (Link to NCBI) NM_142748.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGCCTTCAGTCATACGCCAG 
 Primer Seq. 3'
aatctagaggtaccGCGGCTCAAATACCGTCTTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGCCATTTC AGTCATACGC CAGTTCCTCG GATGAAGAAT CGGACCATGA GGACGCCGCC 
0061 ACAGCCACCA CGAATTCAGA GCCCTCCGCT CCCATTCCGG ATCACCTGCT GCCCGTGGAC 
0121 AAGACACACT CGCTATCCAA GTCCATTGCT GTTTGTGCGG CGCCAACGGT GGTTCCCCTT 
0181 GGAGCATCGG CCGTGCCCCG AACTCTGGAT CCCACGCTCA AGGAGGTAAC CTACAATCCG 
0241 CGCTATGAGG AGATGTATGC TCCGGTAAAG GGTCCGGAGC ATCCGGACCT CACCATGCAG 
0301 CAGCNCGNTC CGCGGAACAC CCTAGCCGGC TACGTAGAGA AGGCCCACAT CAATGCCTTC 
0361 GAATTTGAGA ACCAGCGACG CACCTTTCAC ACCTACGGCT ACGCATTGGA TCCCAGCGTA 
0421 GACGATCAGG CGGACGGCCA GTCTTTTGTG GGTGACCTGC AGTCTGCGTA CGATGACAAT 
0481 GGCAAGACGG TATTTGAGCC GC 
 in silico PCR Fragment
0001 GGGCC--TTC AGTCATACGC CAGTTCCTCG GATGAAGAAT CGGACCATGC GGACGCCGCC 
0061 ACAGCCACCA CGAATTCAGA GCCCTCCGCT CCCATTCCGG ATCACCTGCT GCCCGTGGAC 
0121 AAGACACACT CGCTATCCAA GTCCATTGCT GTTTGTGCGG CGCCAACGGT GGTTCCCCTT 
0181 GGAGCATCGG CCGTGCCCCG AACTCTGGAT CCCACGCTCA AGGAGGTAAC CTACAATCCG 
0241 CGCTATGAGG AGATGTATGC TCCGGTAAAA GGTCCGGAGC ATCCGGACCT CACCATGCAG 
0301 CAGCGCGCTC CGCGGAACAC CCTAGCCGGC TACGTAGAGA AGGCCCACAT CAATGCCTTC 
0361 GAATTTGAGA ACCAGCGACG CACCTTTCAC ACCTACGGCT ACGCATTGGA CCCCAGCGTA 
0421 GACGATCAGG CGGACGGCCA GTCTTTTGTG GGTGACCTGC AGTCTGCGTA CGATGACAAT 
0481 GGCAAGACGG TATTTGAGCC GC 
 Assemble Data

6015R-2.IR_full       1   GGGCCATTTCAGTCATACGCCAGTTCCTCGGATGAAGAATCGGACCATGAGGACGCCGCC 60
                          |||||  |||||||||||||||||||||||||||||||||||||||||| ||||||||||
6015R-2.in silico     1   GGGCC--TTCAGTCATACGCCAGTTCCTCGGATGAAGAATCGGACCATGCGGACGCCGCC 60


6015R-2.IR_full       61  ACAGCCACCACGAATTCAGAGCCCTCCGCTCCCATTCCGGATCACCTGCTGCCCGTGGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6015R-2.in silico     61  ACAGCCACCACGAATTCAGAGCCCTCCGCTCCCATTCCGGATCACCTGCTGCCCGTGGAC 120


6015R-2.IR_full       121 AAGACACACTCGCTATCCAAGTCCATTGCTGTTTGTGCGGCGCCAACGGTGGTTCCCCTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6015R-2.in silico     121 AAGACACACTCGCTATCCAAGTCCATTGCTGTTTGTGCGGCGCCAACGGTGGTTCCCCTT 180


6015R-2.IR_full       181 GGAGCATCGGCCGTGCCCCGAACTCTGGATCCCACGCTCAAGGAGGTAACCTACAATCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6015R-2.in silico     181 GGAGCATCGGCCGTGCCCCGAACTCTGGATCCCACGCTCAAGGAGGTAACCTACAATCCG 240


6015R-2.IR_full       241 CGCTATGAGGAGATGTATGCTCCGGTAAAGGGTCCGGAGCATCCGGACCTCACCATGCAG 300
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
6015R-2.in silico     241 CGCTATGAGGAGATGTATGCTCCGGTAAAAGGTCCGGAGCATCCGGACCTCACCATGCAG 300


6015R-2.IR_full       301 CAGCNCGNTCCGCGGAACACCCTAGCCGGCTACGTAGAGAAGGCCCACATCAATGCCTTC 360
                          |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
6015R-2.in silico     301 CAGCGCGCTCCGCGGAACACCCTAGCCGGCTACGTAGAGAAGGCCCACATCAATGCCTTC 360


6015R-2.IR_full       361 GAATTTGAGAACCAGCGACGCACCTTTCACACCTACGGCTACGCATTGGATCCCAGCGTA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
6015R-2.in silico     361 GAATTTGAGAACCAGCGACGCACCTTTCACACCTACGGCTACGCATTGGACCCCAGCGTA 420


6015R-2.IR_full       421 GACGATCAGGCGGACGGCCAGTCTTTTGTGGGTGACCTGCAGTCTGCGTACGATGACAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6015R-2.in silico     421 GACGATCAGGCGGACGGCCAGTCTTTTGTGGGTGACCTGCAGTCTGCGTACGATGACAAT 480


6015R-2.IR_full       481 GGCAAGACGGTATTTGAGCCGC 502
                          ||||||||||||||||||||||
6015R-2.in silico     481 GGCAAGACGGTATTTGAGCCGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142748.2  CG6015-RA (CG6015), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_170656.1  CG10772-RD, transcript variant D (Fur1), mRNA 
0   NM_206571.1  CG10772-RE, transcript variant E (Fur1), mRNA 
0   NM_170655.1  CG10772-RC, transcript variant C (Fur1), mRNA 
0   NM_206570.1  CG10772-RF, transcript variant F (Fur1), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_133127.1  CG7453-RA, transcript variant A (CG7453), mRNA 
0   NM_167639.1  CG7453-RB, transcript variant B (CG7453), mRNA 
0   NM_137763.3  CG17922-RA (CG17922), mRNA 
0   15  NM_168941.2  CG7421-RA, transcript variant A (Nopp140), mRNA 
0   12  NM_168940.1  CG7421-RB, transcript variant B (Nopp140), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_165953.2  CG30486-RA (CG30486), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_166705.1  CG2679-RB, transcript variant B (gol), mRNA 
0   NM_079140.2  CG2679-RA, transcript variant A (gol), mRNA 
0   NM_140509.1  CG7276-RA, transcript variant A (CG7276), mRNA 
0   NM_206370.1  CG7276-RB, transcript variant B (CG7276), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_165758.1  CG18408-RF, transcript variant F (CAP), mRNA 
0   NM_165757.1  CG18408-RC, transcript variant C (CAP), mRNA 
0   NM_132988.2  CG12993-RA (CG12993), mRNA 
0   NM_142115.1  CG14851-RA (CG14851), mRNA 
0   NM_132017.1  CG3160-RA (CG3160), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.