National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6015R-1 
 Symbol CG6015  Full Name CG6015 
 CG No CG6015  Old CG No CG6015 
 Synonyms CG6015 
 Accession No (Link to NCBI) NM_142748.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||  |||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     1   GGGCC--TTCAGTCATACGCCAGTTCCTCGGATGAAGAATCGGACCATGCGGACGCCGCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACAGCCACCACGAATTCAGAGCCCTCCGCTCCCATTCCGGATCACCTGCTGCCCGTGGAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGACACACTCGCTATCCAAGTCCATTGCTGTTTGTGCGGCGCCAACGGTGGTTCCCCTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGAGCATCGGCCGTGCCCCGAACTCTGGATCCCACGCTCAAGGAGGTAACCTACAATCCG 240

                          ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     241 CGCTATGAGGAGATGTATGCTCCGGTAAAAGGTCCGGAGCATCCGGACCTCACCATGCAG 300

                          |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGCGCGCTCCGCGGAACACCCTAGCCGGCTACGTAGAGAAGGCCCACATCAATGCCTTC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     361 GAATTTGAGAACCAGCGACGCACCTTTCACACCTACGGCTACGCATTGGACCCCAGCGTA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACGATCAGGCGGACGGCCAGTCTTTTGTGGGTGACCTGCAGTCTGCGTACGATGACAAT 480

6015R-1.IR_full       481 GGCAAGACGGTATTTGAGCCGC 502
                          |||||||||||||||||||||| silico     481 GGCAAGACGGTATTTGAGCCGC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142748.2  CG6015-RA (CG6015), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_170656.1  CG10772-RD, transcript variant D (Fur1), mRNA 
0   NM_206571.1  CG10772-RE, transcript variant E (Fur1), mRNA 
0   NM_170655.1  CG10772-RC, transcript variant C (Fur1), mRNA 
0   NM_206570.1  CG10772-RF, transcript variant F (Fur1), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_133127.1  CG7453-RA, transcript variant A (CG7453), mRNA 
0   NM_167639.1  CG7453-RB, transcript variant B (CG7453), mRNA 
0   NM_137763.3  CG17922-RA (CG17922), mRNA 
0   15  NM_168941.2  CG7421-RA, transcript variant A (Nopp140), mRNA 
0   12  NM_168940.1  CG7421-RB, transcript variant B (Nopp140), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_165953.2  CG30486-RA (CG30486), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_166705.1  CG2679-RB, transcript variant B (gol), mRNA 
0   NM_079140.2  CG2679-RA, transcript variant A (gol), mRNA 
0   NM_140509.1  CG7276-RA, transcript variant A (CG7276), mRNA 
0   NM_206370.1  CG7276-RB, transcript variant B (CG7276), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_165758.1  CG18408-RF, transcript variant F (CAP), mRNA 
0   NM_165757.1  CG18408-RC, transcript variant C (CAP), mRNA 
0   NM_132988.2  CG12993-RA (CG12993), mRNA 
0   NM_142115.1  CG14851-RA (CG14851), mRNA 
0   NM_132017.1  CG3160-RA (CG3160), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.