National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5998R-2 
 Symbol Adgf-B  Full Name Adenosine deaminase-related growth factor B 
 CG No CG5998  Old CG No CG5998 
 Synonyms CG5998, ADGF-B, adgfb, Adgf-B 
 Accession No (Link to NCBI) NM_140749.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTCGCCGAGCATTGACCAAATGTGCAAAAATTGGCCACACTACAGTGTCCGTGAGTCGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCCCTCCGGAAACTGTCACCCACGGCGTTCAAGACACTTCGACAAGCAATCGCCAAGGTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGGCACTTAAACATCATGGGTCAGAAGATACGACTGAACGATCGGGAATTAGCGGCCAAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAAGTGATCATGGCCGTCAAGAAGGAAGAGATATCCAAGGGCATACTGGATCCCAGTCAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTCACGCCGGGCCAGCACATCTTTAAGACCCTGGCCGAGGTGCAAAAGTCGCCGATCTTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACCTGATTAAGGGTATGCCGAAGGGCGGCGCGCTTCATGCCCACGATACGGCGCTCTGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCACAGACTACCTCATAAGTCTGACCTACCGGAAGAATCTTTGGATTTGTACCGCTGAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGGGCTGCAAGGCCATTGCTTTCCGGTTTTCCAAGGAGGAGCCCAAGGAAAAACCTGTT 480

5998R-2.IR_full       481 AAGGAATCTATCTGGGAGCC 500
                          |||||||||||||||||||| silico     481 AAGGAATCTATCTGGGAGCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140749.2  CG5998-RA (Adgf-B), mRNA 
3.31   16  NM_206397.1  CG5992-RB, transcript variant B (Adgf-A), mRNA 
3.31   16  NM_079406.2  CG5992-RA, transcript variant A (Adgf-A), mRNA 
0.62   NM_136515.2  CG8709-RA (CG8709), mRNA 
0   NM_079270.1  CG4190-RA (Hsp67Bc), mRNA 
0   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_169562.1  CG3028-RA (Ipp), mRNA 
0   16  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_137195.2  CG8180-RA (CG8180), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_139419.1  CG13925-RA (CG13925), mRNA 
0   NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_058157.3  CG2835-RB, transcript variant B (G-salpha60A), mRNA 
0   NM_176185.1  CG8421-RE, transcript variant E (Asph), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_058158.3  CG2835-RA, transcript variant A (G-salpha60A), mRNA 
0   NM_137119.2  CG10105-RA (CG10105), mRNA 
0   NM_166640.1  CG2835-RC, transcript variant C (G-salpha60A), mRNA 
0   12  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_166907.1  CG14801-RC, transcript variant C (CG14801), mRNA 
0   NM_130589.1  CG14801-RB, transcript variant B (CG14801), mRNA 
0   NM_166906.1  CG14801-RA, transcript variant A (CG14801), mRNA 
0   NM_166908.1  CG14801-RD, transcript variant D (CG14801), mRNA 
0   NM_079705.2  CG5760-RA (rtet), mRNA 
0   NM_164958.1  CG31867-RA (CG31867), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_135360.3  CG7830-RA (CG7830), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.