National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5998R-1 
 Symbol Adgf-B  Full Name Adenosine deaminase-related growth factor B 
 CG No CG5998  Old CG No CG5998 
 Synonyms CG5998, ADGF-B, adgfb, Adgf-B 
 Accession No (Link to NCBI) NM_140749.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTCGCCGAGCATTGACCAAA 
 Primer Seq. 3'
aatctagaggtaccGGCTCCCAGATAGATTCCTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTCGCCGAG CATTGACCAA ATGTGCAAAA ATTGGCCACA CTACAGTGTC CGTGAGTCGG 
0061 TCCCTCCGGA AACTGTCACC CACGGCGTTC AAGACACTTC GACAAGCAAT CGCCAAGGTG 
0121 GGGCACTTAA ACATCATGGG TCAGAAGATA CGACTGAACG ATCGGGAATT AGCGGCCAAC 
0181 AAAGTGATCA TGGCCGTCAA GAAGGAAGAG ATATCCAAGG GCATACTGGA TCCCAGTCAG 
0241 TTCACGCCGG GCCAGCACAT CTTTAAGACC CTGGCCGAGG TGCAAAAGTC GCCGATCTTT 
0301 AACCTGATTA AGGGTATGCC GAAGGGCGGC GCGCTTCATG CCCACGATAC GGCGCTCTGC 
0361 AGCACAGACT ACCTCATAAG TCTGACCTAC CGGAAGAATC TTTGGATTTG TACCGCTGAG 
0421 GAGGGCTGCA AGGCCATTGC TTTCCGGTTT TCCAAGGAGG AGCCCAAGGA AAAACCTGTT 
0481 AAGGAATCTA TCTGGGAGCC  
 in silico PCR Fragment
0001 TGTCGCCGAG CATTGACCAA ATGTGCAAAA ATTGGCCACA CTACAGTGTC CGTGAGTCGG 
0061 TCCCTCCGGA AACTGTCACC CACGGCGTTC AAGACACTTC GACAAGCAAT CGCCAAGGTG 
0121 GGGCACTTAA ACATCATGGG TCAGAAGATA CGACTGAACG ATCGGGAATT AGCGGCCAAC 
0181 AAAGTGATCA TGGCCGTCAA GAAGGAAGAG ATATCCAAGG GCATACTGGA TCCCAGTCAG 
0241 TTCACGCCGG GCCAGCACAT CTTTAAGACC CTGGCCGAGG TGCAAAAGTC GCCGATCTTT 
0301 AACCTGATTA AGGGTATGCC GAAGGGCGGC GCGCTTCATG CCCACGATAC GGCGCTCTGC 
0361 AGCACAGACT ACCTCATAAG TCTGACCTAC CGGAAGAATC TTTGGATTTG TACCGCTGAG 
0421 GAGGGCTGCA AGGCCATTGC TTTCCGGTTT TCCAAGGAGG AGCCCAAGGA AAAACCTGTT 
0481 AAGGAATCTA TCTGGGAGCC  
 Assemble Data

5998R-1.IR_full       1   TGTCGCCGAGCATTGACCAAATGTGCAAAAATTGGCCACACTACAGTGTCCGTGAGTCGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     1   TGTCGCCGAGCATTGACCAAATGTGCAAAAATTGGCCACACTACAGTGTCCGTGAGTCGG 60


5998R-1.IR_full       61  TCCCTCCGGAAACTGTCACCCACGGCGTTCAAGACACTTCGACAAGCAATCGCCAAGGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     61  TCCCTCCGGAAACTGTCACCCACGGCGTTCAAGACACTTCGACAAGCAATCGCCAAGGTG 120


5998R-1.IR_full       121 GGGCACTTAAACATCATGGGTCAGAAGATACGACTGAACGATCGGGAATTAGCGGCCAAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     121 GGGCACTTAAACATCATGGGTCAGAAGATACGACTGAACGATCGGGAATTAGCGGCCAAC 180


5998R-1.IR_full       181 AAAGTGATCATGGCCGTCAAGAAGGAAGAGATATCCAAGGGCATACTGGATCCCAGTCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     181 AAAGTGATCATGGCCGTCAAGAAGGAAGAGATATCCAAGGGCATACTGGATCCCAGTCAG 240


5998R-1.IR_full       241 TTCACGCCGGGCCAGCACATCTTTAAGACCCTGGCCGAGGTGCAAAAGTCGCCGATCTTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     241 TTCACGCCGGGCCAGCACATCTTTAAGACCCTGGCCGAGGTGCAAAAGTCGCCGATCTTT 300


5998R-1.IR_full       301 AACCTGATTAAGGGTATGCCGAAGGGCGGCGCGCTTCATGCCCACGATACGGCGCTCTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     301 AACCTGATTAAGGGTATGCCGAAGGGCGGCGCGCTTCATGCCCACGATACGGCGCTCTGC 360


5998R-1.IR_full       361 AGCACAGACTACCTCATAAGTCTGACCTACCGGAAGAATCTTTGGATTTGTACCGCTGAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     361 AGCACAGACTACCTCATAAGTCTGACCTACCGGAAGAATCTTTGGATTTGTACCGCTGAG 420


5998R-1.IR_full       421 GAGGGCTGCAAGGCCATTGCTTTCCGGTTTTCCAAGGAGGAGCCCAAGGAAAAACCTGTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5998R-1.in silico     421 GAGGGCTGCAAGGCCATTGCTTTCCGGTTTTCCAAGGAGGAGCCCAAGGAAAAACCTGTT 480


5998R-1.IR_full       481 AAGGAATCTATCTGGGAGCC 500
                          ||||||||||||||||||||
5998R-1.in silico     481 AAGGAATCTATCTGGGAGCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140749.2  CG5998-RA (Adgf-B), mRNA 
3.31   16  NM_206397.1  CG5992-RB, transcript variant B (Adgf-A), mRNA 
3.31   16  NM_079406.2  CG5992-RA, transcript variant A (Adgf-A), mRNA 
0.62   NM_136515.2  CG8709-RA (CG8709), mRNA 
0   NM_079270.1  CG4190-RA (Hsp67Bc), mRNA 
0   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_169562.1  CG3028-RA (Ipp), mRNA 
0   16  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_137195.2  CG8180-RA (CG8180), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_139419.1  CG13925-RA (CG13925), mRNA 
0   NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_058157.3  CG2835-RB, transcript variant B (G-salpha60A), mRNA 
0   NM_176185.1  CG8421-RE, transcript variant E (Asph), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_058158.3  CG2835-RA, transcript variant A (G-salpha60A), mRNA 
0   NM_137119.2  CG10105-RA (CG10105), mRNA 
0   NM_166640.1  CG2835-RC, transcript variant C (G-salpha60A), mRNA 
0   12  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_166907.1  CG14801-RC, transcript variant C (CG14801), mRNA 
0   NM_130589.1  CG14801-RB, transcript variant B (CG14801), mRNA 
0   NM_166906.1  CG14801-RA, transcript variant A (CG14801), mRNA 
0   NM_166908.1  CG14801-RD, transcript variant D (CG14801), mRNA 
0   NM_079705.2  CG5760-RA (rtet), mRNA 
0   NM_164958.1  CG31867-RA (CG31867), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_135360.3  CG7830-RA (CG7830), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.