National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5972R-3 
 Symbol Arc-p20  Full Name Arc-p20 
 CG No CG5972  Old CG No CG5972 
 Synonyms Arp-p20, CG5972, P-20 ARC, anon-EST:Posey49, BcDNA:RE43724, Arc-p20 
 Accession No (Link to NCBI) NM_135152.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     1   ATGGCAGCCACATTGAAGCCCTACCTGACCGCCGTGCGACACTCGCTG-ACGGCGGCGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGCCTGCAGGACTTCCCCTCGCAGGTGGTGGAGCGGCACAACAAGCCGGAGGTGGAGAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTGTTCCAGCAAGGAGCTGGTGCTCACGCCCGTCGTCGTGTCGCGCAACGAGCGGGAGAA 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     181 GGTGCTGATCGAGCCGTCCATTAACTCGGTGCGCGTGAGCATCGCCGTG-AAGCAGGCCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACGAGATTGAGCGCATACTGTGCCACAAGTTCACCAGGTTCATGATGCGACGCGCCGAGT 300

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTTCGTCATA-CTGCGCCGCAAGCCCATCGAGGGCTACGACATAAGCTTCCTCATCACC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AACTTCCACACGGAGCAGATGTATAAGCACAAACTGGTGGACTTTGTCATTAGCTTCATG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGGAGATCGACAAGGAGATCAGCGAAATGAAACTGGCGGTCAATGCCAGGGCACGCACC 480

5972R-3.IR_full       481 TGCGCCGAGGAGTTCCTCAAACG 503
                          ||||||||||||||||||||||| silico     481 TGCGCCGAGGAGTTCCTCAAACG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135152.2  CG5972-RA (Arc-p20), mRNA 
0.41   NM_133016.2  CG6398-RA (CG6398), mRNA 
0.41   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   10  NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_131988.1  CG3309-RA (CG3309), mRNA 
0   NM_166835.1  CG2945-RB, transcript variant B (cin), mRNA 
0   NM_001015087.1  CG40267-PA.3 (CG40267), mRNA 
0   NM_057682.2  CG2945-RA, transcript variant A (cin), mRNA 
0   NM_139851.1  CG14834-RA (CG14834), mRNA 
0   NM_136836.2  CG13203-RA, transcript variant A (CG13203), mRNA 
0   NM_001032233.1  CG13203-RB, transcript variant B (CG13203), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_136436.1  CG11125-RA (CG11125), mRNA 
0   12  NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_164524.1  CG9660-RD, transcript variant D (toc), mRNA 
0   NM_001042864.1  CG9660-RE, transcript variant E (toc), mRNA 
0   NM_164525.1  CG9660-RC, transcript variant C (toc), mRNA 
0   NM_164526.1  CG9660-RB, transcript variant B (toc), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   11  NM_132035.1  CG4064-RA (CG4064), mRNA 
0   NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_130663.2  CG2675-RA (Csat), mRNA 
0   NM_141663.2  CG8319-RA (CG8319), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_058010.3  CG8200-RA, transcript variant A (Flo), mRNA 
0   NM_166102.1  CG8200-RB, transcript variant B (Flo), mRNA 
0   NM_137423.1  CG18635-RA (CG18635), mRNA 
0   NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.