National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5972R-1 
 Symbol Arc-p20  Full Name Arc-p20 
 CG No CG5972  Old CG No CG5972 
 Synonyms Arp-p20, CG5972, P-20 ARC, anon-EST:Posey49, BcDNA:RE43724, Arc-p20 
 Accession No (Link to NCBI) NM_135152.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCAGCCACATTGAAGCCC 
 Primer Seq. 3'
aatctagaggtaccCGTTTGAGGAACTCCTCGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCAGCCA CATTGAAGCC CTACCTGACC GCCGTGCGAC ACTCGCTGTA CGGCGGCGAT 
0061 GTGCCTGCAG GACTTCCCCT CGCAGGTGGT GGAGCGGCAC AACAAGCCGG AGGTGGAGAT 
0121 CTGTTCCAGC AAGGAGCTGG TGCTCACGCC CGTCGTCGTG TCGCGCAACG AGCGGGAGAA 
0181 GGTGCTGATC GAGCCGTCCA TTAACTCGGT GCGCGTGAGC ATCGCCGTGN AAGCAGGCCG 
0241 ACGAGATTGA GCGCATACTG TGCCACAAGT TCACCAGGTT CATGATGCGA CGCGCCGAGT 
0301 CGTTCGTCAT ANCTGCGCCG CAAGcCCATC GAGGGCTACG ACATAAGCTT CCTCATCACC 
0361 AACTTCCACA CGGAGCAGAT GTATAAGCAC AAACTGGTGG ACTTTGTCAT TAGCTTCATG 
0421 GAGGAGATCG ACAAGGAGAT CAGCGAAATG AAACTGGCGG TCAATgCCAG GGCACGCACC 
0481 TGCGCCGAGG AGTTCCTCAA ACG 
 in silico PCR Fragment
0001 ATGGCAGCCA CATTGAAGCC CTACCTGACC GCCGTGCGAC ACTCGCTG-A CGGCGGCGAT 
0061 GTGCCTGCAG GACTTCCCCT CGCAGGTGGT GGAGCGGCAC AACAAGCCGG AGGTGGAGAT 
0121 CTGTTCCAGC AAGGAGCTGG TGCTCACGCC CGTCGTCGTG TCGCGCAACG AGCGGGAGAA 
0181 GGTGCTGATC GAGCCGTCCA TTAACTCGGT GCGCGTGAGC ATCGCCGTG- AAGCAGGCCG 
0241 ACGAGATTGA GCGCATACTG TGCCACAAGT TCACCAGGTT CATGATGCGA CGCGCCGAGT 
0301 CGTTCGTCAT A-CTGCGCCG CAAGCCCATC GAGGGCTACG ACATAAGCTT CCTCATCACC 
0361 AACTTCCACA CGGAGCAGAT GTATAAGCAC AAACTGGTGG ACTTTGTCAT TAGCTTCATG 
0421 GAGGAGATCG ACAAGGAGAT CAGCGAAATG AAACTGGCGG TCAATGCCAG GGCACGCACC 
0481 TGCGCCGAGG AGTTCCTCAA ACG 
 Assemble Data

5972R-1.IR_full       1   ATGGCAGCCACATTGAAGCCCTACCTGACCGCCGTGCGACACTCGCTGTACGGCGGCGAT 60
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
5972R-1.in silico     1   ATGGCAGCCACATTGAAGCCCTACCTGACCGCCGTGCGACACTCGCTG-ACGGCGGCGAT 60


5972R-1.IR_full       61  GTGCCTGCAGGACTTCCCCTCGCAGGTGGTGGAGCGGCACAACAAGCCGGAGGTGGAGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5972R-1.in silico     61  GTGCCTGCAGGACTTCCCCTCGCAGGTGGTGGAGCGGCACAACAAGCCGGAGGTGGAGAT 120


5972R-1.IR_full       121 CTGTTCCAGCAAGGAGCTGGTGCTCACGCCCGTCGTCGTGTCGCGCAACGAGCGGGAGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5972R-1.in silico     121 CTGTTCCAGCAAGGAGCTGGTGCTCACGCCCGTCGTCGTGTCGCGCAACGAGCGGGAGAA 180


5972R-1.IR_full       181 GGTGCTGATCGAGCCGTCCATTAACTCGGTGCGCGTGAGCATCGCCGTGNAAGCAGGCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
5972R-1.in silico     181 GGTGCTGATCGAGCCGTCCATTAACTCGGTGCGCGTGAGCATCGCCGTG-AAGCAGGCCG 240


5972R-1.IR_full       241 ACGAGATTGAGCGCATACTGTGCCACAAGTTCACCAGGTTCATGATGCGACGCGCCGAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5972R-1.in silico     241 ACGAGATTGAGCGCATACTGTGCCACAAGTTCACCAGGTTCATGATGCGACGCGCCGAGT 300


5972R-1.IR_full       301 CGTTCGTCATANCTGCGCCGCAAGCCCATCGAGGGCTACGACATAAGCTTCCTCATCACC 360
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
5972R-1.in silico     301 CGTTCGTCATA-CTGCGCCGCAAGCCCATCGAGGGCTACGACATAAGCTTCCTCATCACC 360


5972R-1.IR_full       361 AACTTCCACACGGAGCAGATGTATAAGCACAAACTGGTGGACTTTGTCATTAGCTTCATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5972R-1.in silico     361 AACTTCCACACGGAGCAGATGTATAAGCACAAACTGGTGGACTTTGTCATTAGCTTCATG 420


5972R-1.IR_full       421 GAGGAGATCGACAAGGAGATCAGCGAAATGAAACTGGCGGTCAATGCCAGGGCACGCACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5972R-1.in silico     421 GAGGAGATCGACAAGGAGATCAGCGAAATGAAACTGGCGGTCAATGCCAGGGCACGCACC 480


5972R-1.IR_full       481 TGCGCCGAGGAGTTCCTCAAACG 503
                          |||||||||||||||||||||||
5972R-1.in silico     481 TGCGCCGAGGAGTTCCTCAAACG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135152.2  CG5972-RA (Arc-p20), mRNA 
0.41   NM_133016.2  CG6398-RA (CG6398), mRNA 
0.41   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   10  NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_131988.1  CG3309-RA (CG3309), mRNA 
0   NM_166835.1  CG2945-RB, transcript variant B (cin), mRNA 
0   NM_001015087.1  CG40267-PA.3 (CG40267), mRNA 
0   NM_057682.2  CG2945-RA, transcript variant A (cin), mRNA 
0   NM_139851.1  CG14834-RA (CG14834), mRNA 
0   NM_136836.2  CG13203-RA, transcript variant A (CG13203), mRNA 
0   NM_001032233.1  CG13203-RB, transcript variant B (CG13203), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_136436.1  CG11125-RA (CG11125), mRNA 
0   12  NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_164524.1  CG9660-RD, transcript variant D (toc), mRNA 
0   NM_001042864.1  CG9660-RE, transcript variant E (toc), mRNA 
0   NM_164525.1  CG9660-RC, transcript variant C (toc), mRNA 
0   NM_164526.1  CG9660-RB, transcript variant B (toc), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   11  NM_132035.1  CG4064-RA (CG4064), mRNA 
0   NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_130663.2  CG2675-RA (Csat), mRNA 
0   NM_141663.2  CG8319-RA (CG8319), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_058010.3  CG8200-RA, transcript variant A (Flo), mRNA 
0   NM_166102.1  CG8200-RB, transcript variant B (Flo), mRNA 
0   NM_137423.1  CG18635-RA (CG18635), mRNA 
0   NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.