National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5961R-4 
 Symbol CG5961  Full Name CG5961 
 CG No CG5961  Old CG No CG5961 
 Synonyms CG5961 
 Accession No (Link to NCBI) NM_141949.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCTGGCGAGACATGTTCATC 
 Primer Seq. 3'
aatctagaggtaccGTCAAATCGAACTCGGAGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCTGGCGAG ACATGTTCAT CCGCCGAGAC CGAGTTCTTT TCAACGGCTG CTACATCAGC 
0061 AAGACTACGT ACCTGAGAAT GGGCGAGAAC AGCTTCCAGG ATCAGTTCTA CCGTCCTGTG 
0121 CAACTGGTGG AGTACTATCG CTACATTCGC TTTCTGCCCG ATGGCAAGGT GCTGATGATG 
0181 ACGNCTGCCG ATGAGCCGGC GCAAGGTGTA TCCAAACTGA AGCACGTGAA CAACGTACGG 
0241 GCGGAAATGC TTCGGGGTCG CTATCGTCTC TTCGGGAGCA CAGTCACTCT GGTGCTGCAA 
0301 AAGTCGCAGC AGCGAGGGCC GGCTAACGTG CGGCAGAGGC GAGGGAGTAT CATGCCAGTG 
0361 GATGAGGACT CCTCACAGTT CCTGATCGAG CTGCGCATCG CAGGCACCAC CAAGCGCCGA 
0421 TGCGCCCAGT TGGTTTGGTC ACATTACACG CTCGTGCAGA AGCGCAACAA GGTGGACATC 
0481 AGCTCCGAGT TCGATTTGNN AC 
 in silico PCR Fragment
0001 TCCTGGCGAG ACATGTTCAT CCGCCGAGAC CGAGTTCTTT TCAACGGCTG CTACATCAGC 
0061 AAGACTACGT ACCTGAGAAT GGGCGAGAAC AGCTTCCAGG ATCAGTTCTA CCGTCCTGTG 
0121 CAACTGGTGG AGTACTATCG CTACATTCGC TTTCTGCCCG ATGGCAAGGT GCTGATGATG 
0181 ACGACTGCCG ATGAGCCGGC GCAAGGTGTA TCCAAACTGA AGCACGTGAA CAACGTACGG 
0241 GCGGAAATGC TTCGGGGTCG CTATCGTCTC TTCGGGAGCA CAGTCACTCT GGTGCTGCAA 
0301 AAGTCGCAGC AGCGAGGGCC GGCTAACGTG CGGCAGAGGC GAGGGAGTAT CATGCCAGTG 
0361 GATGAGGACT CCTCACAGTT CCTGATCGAG CTGCGCATCG CAGGCACCAC CAAGCGCCGA 
0421 TGCGCCCAGT TGGTTTGGTC ACATTACACG CTCGTGCAGA AGCGCAACAA GGTGGACATC 
0481 AGCTCCGAGT TCGATTTG-- AC 
 Assemble Data

5961R-4.IR_full       1   TCCTGGCGAGACATGTTCATCCGCCGAGACCGAGTTCTTTTCAACGGCTGCTACATCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     1   TCCTGGCGAGACATGTTCATCCGCCGAGACCGAGTTCTTTTCAACGGCTGCTACATCAGC 60


5961R-4.IR_full       61  AAGACTACGTACCTGAGAATGGGCGAGAACAGCTTCCAGGATCAGTTCTACCGTCCTGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     61  AAGACTACGTACCTGAGAATGGGCGAGAACAGCTTCCAGGATCAGTTCTACCGTCCTGTG 120


5961R-4.IR_full       121 CAACTGGTGGAGTACTATCGCTACATTCGCTTTCTGCCCGATGGCAAGGTGCTGATGATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     121 CAACTGGTGGAGTACTATCGCTACATTCGCTTTCTGCCCGATGGCAAGGTGCTGATGATG 180


5961R-4.IR_full       181 ACGNCTGCCGATGAGCCGGCGCAAGGTGTATCCAAACTGAAGCACGTGAACAACGTACGG 240
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     181 ACGACTGCCGATGAGCCGGCGCAAGGTGTATCCAAACTGAAGCACGTGAACAACGTACGG 240


5961R-4.IR_full       241 GCGGAAATGCTTCGGGGTCGCTATCGTCTCTTCGGGAGCACAGTCACTCTGGTGCTGCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     241 GCGGAAATGCTTCGGGGTCGCTATCGTCTCTTCGGGAGCACAGTCACTCTGGTGCTGCAA 300


5961R-4.IR_full       301 AAGTCGCAGCAGCGAGGGCCGGCTAACGTGCGGCAGAGGCGAGGGAGTATCATGCCAGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     301 AAGTCGCAGCAGCGAGGGCCGGCTAACGTGCGGCAGAGGCGAGGGAGTATCATGCCAGTG 360


5961R-4.IR_full       361 GATGAGGACTCCTCACAGTTCCTGATCGAGCTGCGCATCGCAGGCACCACCAAGCGCCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     361 GATGAGGACTCCTCACAGTTCCTGATCGAGCTGCGCATCGCAGGCACCACCAAGCGCCGA 420


5961R-4.IR_full       421 TGCGCCCAGTTGGTTTGGTCACATTACACGCTCGTGCAGAAGCGCAACAAGGTGGACATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5961R-4.in silico     421 TGCGCCCAGTTGGTTTGGTCACATTACACGCTCGTGCAGAAGCGCAACAAGGTGGACATC 480


5961R-4.IR_full       481 AGCTCCGAGTTCGATTTGNNAC 502
                          ||||||||||||||||||  ||
5961R-4.in silico     481 AGCTCCGAGTTCGATTTG--AC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141949.2  CG5961-RA (CG5961), mRNA 
0   10  21  25  NM_168626.1  CG7439-RC, transcript variant C (AGO2), mRNA 
0   10  21  25  NM_140518.1  CG7439-RB, transcript variant B (AGO2), mRNA 
0   NM_140308.2  CG4300-RB, transcript variant B (CG4300), mRNA 
0   NM_168496.1  CG4300-RA, transcript variant A (CG4300), mRNA 
0   NM_166131.1  CG8322-RB, transcript variant B (ATPCL), mRNA 
0   NM_079031.1  CG8322-RA, transcript variant A (ATPCL), mRNA 
0   NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
0   NM_176511.1  CG31247-RC, transcript variant C (tinc), mRNA 
0   NM_079186.2  CG14981-RA, transcript variant A (mge), mRNA 
0   NM_168044.1  CG14981-RB, transcript variant B (mge), mRNA 
0   NM_170659.1  CG7835-RA (CG7835), mRNA 
0   NM_139641.2  CG7447-RA, transcript variant A (CG7447), mRNA 
0   NM_176283.1  CG7447-RB, transcript variant B (CG7447), mRNA 
0   NM_057714.3  CG12296-RA (klu), mRNA 
0   NM_080139.3  CG8171-RA (dup), mRNA 
0   NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
0   NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
0   NM_140297.2  CG9760-RB (CG9760), mRNA 
0   NM_142981.2  CG13610-RA (Orct2), mRNA 
0   NM_001038865.1  CG33981-RA, transcript variant A (CG33981), mRNA 
0   NM_001038866.1  CG33981-RB, transcript variant B (CG33981), mRNA 
0   NM_206158.1  CG6355-RB, transcript variant B (CG6355), mRNA 
0   NM_137425.3  CG6355-RA, transcript variant A (CG6355), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_164809.3  CG13383-RB (CSN8), mRNA 
0   NM_079572.2  CG9484-RA (hyd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.