National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5925R-3 
 Symbol desat2  Full Name desat2 
 CG No CG5925  Old CG No CG5925 
 Synonyms desat2/Fad, ds2, CG5925, 7-11HD, desat, Fad, desat2, Fatty acid desaturase, desaturase, 7,11-heptacosadiene modifier, desaturase2 
 Accession No (Link to NCBI) NM_141944.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGTTGAAACGAGCTGAGAA 
 Primer Seq. 3'
aatctagaggtaccCCAGCGGCATGAGGATATAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGTTGAAA CGAGCTGAGA AGCGTCGGCT ACCCCTAGTC TGGCGGAATA TAATCCTGTT 
0061 CGCATTGGTC CACCTGGCTG CTCTATATGG CCTGCACTCC ATATTCACAA GGGCGAAACT 
0121 GGCAACCACA CTTTTCGCTG CCGGATTGTA TATCATTGGC ATGCTGGGCG TTACAGCCGG 
0181 TGCCCATCGT CTATGGGCGC ATCGCACCTA CAAGGCCAAG TGGCCCCTGC GCCTGCTCCT 
0241 GGTCATCTTC AATACGATCG CCTTTCAGGA TGCCGTCTAC CATTGGGCCC GTGACCATCG 
0301 CGTCCACCAC AAATACTCGG AAACTGATGC AGATCCTCAC AACGCCACCA GGGGATTTTT 
0361 CTTCTCGCAT GTGGGCTGGC TGCTCTGCAA AAAGCATCCG GATATTAAGG AAAAGGGAAG 
0421 GGGACTGGAT CTCTCCGACC TGCGCGCCGA TCCCATCTTG ATGTTCCAAC GAAAGCACTA 
0481 TTATATCCTC ATGCCGCTGG  
 in silico PCR Fragment
0001 CCAGTTGAAA CGAGCTGAGA AGCGTCGGCT ACCCCTAGTC TGGCGGAATA TAATCCTGTT 
0061 CGCATTGGTC CACCTGGCTG CTCTATATGG CCTGCACTCC ATATTCACAA GGGCGAAACT 
0121 GGCAACCACA CTTTTCGCTG CCGGATTGTA TATCATTGGC ATGCTGGGCG TTACAGCCGG 
0181 TGCCCATCGT CTATGGGCGC ATCGCACCTA CAAGGCCAAG TGGCCCCTGC GCCTGCTCCT 
0241 GGTCATCTTC AATACGATCG CCTTTCAGGA TGCCGTCTAC CATTGGGCCC GTGACCATCG 
0301 CGTCCACCAC AAATACTCGG AAACTGATGC AGATCCTCAC AACGCCACCA GGGGATTTTT 
0361 CTTCTCGCAT GTGGGCTGGC TGCTCTGCAA AAAGCATCCG GATATTAAGG AAAAGGGAAG 
0421 GGGACTGGAT CTCTCCGACC TGCGCGCCGA TCCCATCTTG ATGTTCCAAC GAAAGCACTA 
0481 TTATATCCTC ATGCCGCTGG  
 Assemble Data

5925R-3.IR_full       1   CCAGTTGAAACGAGCTGAGAAGCGTCGGCTACCCCTAGTCTGGCGGAATATAATCCTGTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     1   CCAGTTGAAACGAGCTGAGAAGCGTCGGCTACCCCTAGTCTGGCGGAATATAATCCTGTT 60


5925R-3.IR_full       61  CGCATTGGTCCACCTGGCTGCTCTATATGGCCTGCACTCCATATTCACAAGGGCGAAACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     61  CGCATTGGTCCACCTGGCTGCTCTATATGGCCTGCACTCCATATTCACAAGGGCGAAACT 120


5925R-3.IR_full       121 GGCAACCACACTTTTCGCTGCCGGATTGTATATCATTGGCATGCTGGGCGTTACAGCCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     121 GGCAACCACACTTTTCGCTGCCGGATTGTATATCATTGGCATGCTGGGCGTTACAGCCGG 180


5925R-3.IR_full       181 TGCCCATCGTCTATGGGCGCATCGCACCTACAAGGCCAAGTGGCCCCTGCGCCTGCTCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     181 TGCCCATCGTCTATGGGCGCATCGCACCTACAAGGCCAAGTGGCCCCTGCGCCTGCTCCT 240


5925R-3.IR_full       241 GGTCATCTTCAATACGATCGCCTTTCAGGATGCCGTCTACCATTGGGCCCGTGACCATCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     241 GGTCATCTTCAATACGATCGCCTTTCAGGATGCCGTCTACCATTGGGCCCGTGACCATCG 300


5925R-3.IR_full       301 CGTCCACCACAAATACTCGGAAACTGATGCAGATCCTCACAACGCCACCAGGGGATTTTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     301 CGTCCACCACAAATACTCGGAAACTGATGCAGATCCTCACAACGCCACCAGGGGATTTTT 360


5925R-3.IR_full       361 CTTCTCGCATGTGGGCTGGCTGCTCTGCAAAAAGCATCCGGATATTAAGGAAAAGGGAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     361 CTTCTCGCATGTGGGCTGGCTGCTCTGCAAAAAGCATCCGGATATTAAGGAAAAGGGAAG 420


5925R-3.IR_full       421 GGGACTGGATCTCTCCGACCTGCGCGCCGATCCCATCTTGATGTTCCAACGAAAGCACTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5925R-3.in silico     421 GGGACTGGATCTCTCCGACCTGCGCGCCGATCCCATCTTGATGTTCCAACGAAAGCACTA 480


5925R-3.IR_full       481 TTATATCCTCATGCCGCTGG 500
                          ||||||||||||||||||||
5925R-3.in silico     481 TTATATCCTCATGCCGCTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141944.1  CG5925-RA (desat2), mRNA 
3.73   18  48  81  64  NM_169467.1  CG5887-RD, transcript variant D (desat1), mRNA 
3.73   18  48  81  64  NM_169465.1  CG5887-RB, transcript variant B (desat1), mRNA 
3.73   18  48  81  64  NM_169468.1  CG5887-RE, transcript variant E (desat1), mRNA 
3.73   18  48  81  64  NM_169466.1  CG5887-RC, transcript variant C (desat1), mRNA 
3.73   18  48  81  64  NM_144474.1  CG5887-RA, transcript variant A (desat1), mRNA 
0   33  53  NM_143709.2  CG7923-RA (Fad2), mRNA 
0   NM_058161.3  CG5595-RA (Sce), mRNA 
0   NM_139986.2  CG6282-RA, transcript variant A (CG6282), mRNA 
0   NM_176302.1  CG6282-RB, transcript variant B (CG6282), mRNA 
0   NM_136524.2  CG2291-RA (CG2291), mRNA 
0   NM_079350.4  CG3297-RA, transcript variant A (mnd), mRNA 
0   NM_168600.1  CG3297-RB, transcript variant B (mnd), mRNA 
0   NM_168601.1  CG3297-RC, transcript variant C (mnd), mRNA 
0   NM_135918.2  CG4587-RA (CG4587), mRNA 
0   NM_079336.2  CG7002-RA (Hml), mRNA 
0   NM_142881.2  CG6763-RA (CG6763), mRNA 
0   13  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   12  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   12  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   10  NM_144453.2  CG13061-RA (Nplp3), mRNA 
0   NM_165544.1  CG2092-RA, transcript variant A (scra), mRNA 
0   NM_165543.1  CG2092-RB, transcript variant B (scra), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_143708.2  CG5258-RA (NHP2), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_134625.2  CG17600-RA, transcript variant A (CG17600), mRNA 
0   NM_143159.1  CG5028-RA (CG5028), mRNA 
0   NM_166493.1  CG30401-RB, transcript variant B (CG30401), mRNA 
0   NM_166494.1  CG30401-RA, transcript variant A (CG30401), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.