National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5925R-1 
 Symbol desat2  Full Name desat2 
 CG No CG5925  Old CG No CG5925 
 Synonyms desat2/Fad, ds2, CG5925, 7-11HD, desat, Fad, desat2, Fatty acid desaturase, desaturase, 7,11-heptacosadiene modifier, desaturase2 
 Accession No (Link to NCBI) NM_141944.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCAGTTGAAACGAGCTGAGAAGCGTCGGCTACCCCTAGTCTGGCGGAATATAATCCTGTT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCATTGGTCCACCTGGCTGCTCTATATGGCCTGCACTCCATATTCACAAGGGCGAAACT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCAACCACACTTTTCGCTGCCGGATTGTATATCATTGGCATGCTGGGCGTTACAGCCGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGCCCATCGTCTATGGGCGCATCGCACCTACAAGGCCAAGTGGCCCCTGCGCCTGCTCCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTCATCTTCAATACGATCGCCTTTCAGGATGCCGTCTACCATTGGGCCCGTGACCATCG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTCCACCACAAATACTCGGAAACTGATGCAGATCCTCACAACGCCACCAGGGGATTTTT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTTCTCGCATGTGGGCTGGCTGCTCTGCAAAAAGCATCCGGATATTAAGGAAAAGGGAAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGGACTGGATCTCTCCGACCTGCGCGCCGATCCCATCTTGATGTTCCAACGAAAGCACTA 480

5925R-1.IR_full       481 TTATATCCTCATGCCGCTGG 500
                          |||||||||||||||||||| silico     481 TTATATCCTCATGCCGCTGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141944.1  CG5925-RA (desat2), mRNA 
3.73   18  48  81  64  NM_169467.1  CG5887-RD, transcript variant D (desat1), mRNA 
3.73   18  48  81  64  NM_169465.1  CG5887-RB, transcript variant B (desat1), mRNA 
3.73   18  48  81  64  NM_169468.1  CG5887-RE, transcript variant E (desat1), mRNA 
3.73   18  48  81  64  NM_169466.1  CG5887-RC, transcript variant C (desat1), mRNA 
3.73   18  48  81  64  NM_144474.1  CG5887-RA, transcript variant A (desat1), mRNA 
0   33  53  NM_143709.2  CG7923-RA (Fad2), mRNA 
0   NM_058161.3  CG5595-RA (Sce), mRNA 
0   NM_139986.2  CG6282-RA, transcript variant A (CG6282), mRNA 
0   NM_176302.1  CG6282-RB, transcript variant B (CG6282), mRNA 
0   NM_136524.2  CG2291-RA (CG2291), mRNA 
0   NM_079350.4  CG3297-RA, transcript variant A (mnd), mRNA 
0   NM_168600.1  CG3297-RB, transcript variant B (mnd), mRNA 
0   NM_168601.1  CG3297-RC, transcript variant C (mnd), mRNA 
0   NM_135918.2  CG4587-RA (CG4587), mRNA 
0   NM_079336.2  CG7002-RA (Hml), mRNA 
0   NM_142881.2  CG6763-RA (CG6763), mRNA 
0   13  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   12  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   12  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   10  NM_144453.2  CG13061-RA (Nplp3), mRNA 
0   NM_165544.1  CG2092-RA, transcript variant A (scra), mRNA 
0   NM_165543.1  CG2092-RB, transcript variant B (scra), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_143708.2  CG5258-RA (NHP2), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_134625.2  CG17600-RA, transcript variant A (CG17600), mRNA 
0   NM_143159.1  CG5028-RA (CG5028), mRNA 
0   NM_166493.1  CG30401-RB, transcript variant B (CG30401), mRNA 
0   NM_166494.1  CG30401-RA, transcript variant A (CG30401), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.