National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5917R-1 
 Symbol CG34420  Full Name
 CG No CG34420  Old CG No CG5917 
 Synonyms FBgn0085449, CG14129, CG5917, CG34420 
 Accession No (Link to NCBI) NM_140259.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGATTGCCCGACGTCACCGA 
 Primer Seq. 3'
aatctagaggtaccTGCTGTGGGCGTACTTGCGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGATTGCCC GACGTcACCG AGCACTCAAA CATCCGCCGC ACACTGTCCC GCCAGAACTC 
0061 GATCTCGAAC AGCGATTCCG GCGGCGAGAT AGCCAGCATC CAGAAGTCAA AGGTGAACTT 
0121 TGGCAATCCC CTCGCCGGCG GCGTGGNTCG TCGGTGGAGA TATAGTTGGT CTGGACGCCA 
0181 AGTCGCCCAC ATCGCTGGGT TCCACGACTG GAGCTGGCGC CACTGGTAAA GCGAAGGGAA 
0241 AGGCGTCAAG GAAGGCGAAT GCCGGACCAG ATGGCGGACA GAAGGGCAGG AGAGGATCCT 
0301 GGCTGGTGGC CATCACCCTG GTCAGCGCCA TCTGTCTACT gGCCATCGCC GCCACTTTGG 
0361 CCTACCAGCA CTTCCTTATG GNGCCCAGCC GCAATTCCCA TGCCCAAAGA CTGAGAATCG 
0421 TTCGTCGAAT CCTGCGTGAG GTGcCGCTGG TCGACGGGCA CAACAATTAT GCCTGGAATG 
0481 TTCGCAAGTA CGCCCACAGC A 
 in silico PCR Fragment
0001 TGGATTGCCC GACGTCACCG AGCACTCGAA CATCCGCCGC ACACTGTCCC GCCAGAACTC 
0061 GATCTCGAAC AGCGATTCCG GCGGCGAGAT AGCCAGCATC CAGAAGTCAA AGGTGAACTT 
0121 TGGCAATCCC CTCGCCGGCG GCGTGG-TCG TCGGTGGAGA TATAGTTGGT CTGGACGCCA 
0181 AGTCGCCCAC ATCGCTGGGT TCCACGACTG GAGCTGGCGC CACTGGTAAA GCGAAGGGAA 
0241 AGGCGTCAAG GAAGGCGAAT GCCGGACCAG ATGGCGGACA GAAGGGCAGG AGAGGATCCT 
0301 GGCTGGTGGC CATCACCCTG GTCAGCGCCA TCTGTCTACT GGCCATCGCC GCCACTTTGG 
0361 CCTACCAGCA CTTCCTTATG GCGCCCAGCC GCAATTCCCA TGCCCAAAGA CTGAGAATCG 
0421 TTCGTCGAAT CCTGCGTGAG GTGCCGCTGG TCGACGGGCA CAACAATTAT GCCTGGAATG 
0481 TTCGCAAGTA CGCCCACAGC A 
 Assemble Data

5917R-1.IR_full       1   TGGATTGCCCGACGTCACCGAGCACTCAAACATCCGCCGCACACTGTCCCGCCAGAACTC 60
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
5917R-1.in silico     1   TGGATTGCCCGACGTCACCGAGCACTCGAACATCCGCCGCACACTGTCCCGCCAGAACTC 60


5917R-1.IR_full       61  GATCTCGAACAGCGATTCCGGCGGCGAGATAGCCAGCATCCAGAAGTCAAAGGTGAACTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5917R-1.in silico     61  GATCTCGAACAGCGATTCCGGCGGCGAGATAGCCAGCATCCAGAAGTCAAAGGTGAACTT 120


5917R-1.IR_full       121 TGGCAATCCCCTCGCCGGCGGCGTGGNTCGTCGGTGGAGATATAGTTGGTCTGGACGCCA 180
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
5917R-1.in silico     121 TGGCAATCCCCTCGCCGGCGGCGTGG-TCGTCGGTGGAGATATAGTTGGTCTGGACGCCA 180


5917R-1.IR_full       181 AGTCGCCCACATCGCTGGGTTCCACGACTGGAGCTGGCGCCACTGGTAAAGCGAAGGGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5917R-1.in silico     181 AGTCGCCCACATCGCTGGGTTCCACGACTGGAGCTGGCGCCACTGGTAAAGCGAAGGGAA 240


5917R-1.IR_full       241 AGGCGTCAAGGAAGGCGAATGCCGGACCAGATGGCGGACAGAAGGGCAGGAGAGGATCCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5917R-1.in silico     241 AGGCGTCAAGGAAGGCGAATGCCGGACCAGATGGCGGACAGAAGGGCAGGAGAGGATCCT 300


5917R-1.IR_full       301 GGCTGGTGGCCATCACCCTGGTCAGCGCCATCTGTCTACTGGCCATCGCCGCCACTTTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5917R-1.in silico     301 GGCTGGTGGCCATCACCCTGGTCAGCGCCATCTGTCTACTGGCCATCGCCGCCACTTTGG 360


5917R-1.IR_full       361 CCTACCAGCACTTCCTTATGGNGCCCAGCCGCAATTCCCATGCCCAAAGACTGAGAATCG 420
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
5917R-1.in silico     361 CCTACCAGCACTTCCTTATGGCGCCCAGCCGCAATTCCCATGCCCAAAGACTGAGAATCG 420


5917R-1.IR_full       421 TTCGTCGAATCCTGCGTGAGGTGCCGCTGGTCGACGGGCACAACAATTATGCCTGGAATG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5917R-1.in silico     421 TTCGTCGAATCCTGCGTGAGGTGCCGCTGGTCGACGGGCACAACAATTATGCCTGGAATG 480


5917R-1.IR_full       481 TTCGCAAGTACGCCCACAGCA 501
                          |||||||||||||||||||||
5917R-1.in silico     481 TTCGCAAGTACGCCCACAGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140259.1  CG5917-RA (CG5917), mRNA 
0   NM_135425.2  CG9573-RA (CG9573), mRNA 
0   NM_135424.3  CG13102-RA (CG13102), mRNA 
0   NM_140155.2  CG7958-RA, transcript variant A (tna), mRNA 
0   NM_168422.1  CG7958-RB, transcript variant B (tna), mRNA 
0   NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 
0   NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
0   NM_139869.1  CG8543-RA (CG8543), mRNA 
0   NM_134592.2  CG15445-RD, transcript variant D (CG15445), mRNA 
0   NM_167730.1  CG15445-RB, transcript variant B (CG15445), mRNA 
0   NM_167731.1  CG15445-RC, transcript variant C (CG15445), mRNA 
0   NM_167729.1  CG15445-RA, transcript variant A (CG15445), mRNA 
0   NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0   NM_168608.1  CG16959-RB, transcript variant B (CG16959), mRNA 
0   NM_140493.2  CG16959-RA, transcript variant A (CG16959), mRNA 
0   NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0   NM_140560.2  CG17032-RA (CG17032), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_140091.2  CG6757-RA (SH3PX1), mRNA 
0   NM_132801.1  CG15641-RA (CG15641), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_167675.1  CG14213-RA, transcript variant A (CG14213), mRNA 
0   NM_134491.2  CG14213-RB, transcript variant B (CG14213), mRNA 
0   NM_141574.2  CG13318-RA (CG13318), mRNA 
0   NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
0   NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
0   NM_175969.1  CG33113-RF, transcript variant F (Rtnl1), mRNA 
0   NM_130658.2  CG10260-RB (CG10260), mRNA 
0   NM_130685.1  CG14420-RA (CG14420), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.