National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5893R-2 
 Symbol Full Name Dichaete 
 CG No CG5893  Old CG No CG5893 
 Synonyms CG5893, fish, SOXB2.1, SOX70D, SOXDP, Sox70D, l(3)LG9, DM63, DM36, DM33, DM23, DM10, SOX70, Sry-rDM63, Sry-rDM36, Sry-rDM33, Sry-rDM23, Sry-rDM10, loD, D, Sox70 
 Accession No (Link to NCBI) NM_079342.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCACCTTATCGACACAC 
 Primer Seq. 3'
aatctagaggtaccATCTTGGGGTTATCCTTGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCACCT TATCGACACA CCCCAATTAC GGTTTCCATT TGGGTCAGGC CCAAGGCTTG 
0061 GAGGACTACG CACCGCAAAG TCAGCTCCAG CTGAGTCCCG GCATGGACAT GGATATCAAG 
0121 CGTGTGCTGC ACTACTCCCA ANAGCCTGGC ANGCCATGGN CGGATCGCCC AATGGNACCC 
0181 GCCGGCCAGG GTGTGAACGG ATCCTCGGGC ATGGGTCACC ACATGTCCAG TCACATGACC 
0241 CCGCACCACA TGCANCCAGG CGGTCTCCGC CCAACAGACC TTGTCGCCCA ACAGTTCCAT 
0301 CGGATCCGCC GGCAGTCTGG GTAGCCAGAG CAGCCTGGGC AGCAATGGCA GTGGTCTCAA 
0361 CTCCAGTTCG GGTCACCAGT CCGCCGGCAT GCACAGTTTG GCCACATCGC CGGGACAAGA 
0421 GGGTCACATC AAGCGTCCAA TGAACGCGTT CATGGTCTGG TNCCCGCCTG CAGCGTCGTC 
0481 AGATCGCCAA GGATAACCCC AAGAT 
 in silico PCR Fragment
0001 ATGGCCACCT TATCGACACA CCCCAATTAC GGTTTCCATT TGGGTCAGGC CCAAGGCTTG 
0061 GAGGACTACG CACCGCAAAG TCAGCTCCAG CTGAGTCCCG GCATGGACAT GGATATCAAG 
0121 CGTGTGCTGC ACTACTCCCA A-AGCCTGGC A-GCCATGGG CGGATCGCCC AATGG-ACCC 
0181 GCCGGCCAGG GTGTGAACGG ATCCTCGGGC ATGGGTCACC ACATGTCCAG TCACATGACC 
0241 CCGCACCACA TGCA-CCAGG CGGTCTCCGC CCAACAGACC TTGTCGCCCA ACAGTTCCAT 
0301 CGGATCCGCC GGCAGTCTGG GTAGCCAGAG CAGCCTGGGC AGCAATGGCA GTGGTCTCAA 
0361 CTCCAGTTCG GGTCACCAGT CCGCCGGCAT GCACAGTTTG GCCACATCGC CGGGACAAGA 
0421 GGGTCACATC AAGCGTCCAA TGAACGCGTT CATGGTCTGG T-CCCGCCTG CAGCGTCGTC 
0481 AGATCGCCAA GGATAACCCC AAGAT 
 Assemble Data

5893R-2.IR_full       1   ATGGCCACCTTATCGACACACCCCAATTACGGTTTCCATTTGGGTCAGGCCCAAGGCTTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5893R-2.in silico     1   ATGGCCACCTTATCGACACACCCCAATTACGGTTTCCATTTGGGTCAGGCCCAAGGCTTG 60


5893R-2.IR_full       61  GAGGACTACGCACCGCAAAGTCAGCTCCAGCTGAGTCCCGGCATGGACATGGATATCAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5893R-2.in silico     61  GAGGACTACGCACCGCAAAGTCAGCTCCAGCTGAGTCCCGGCATGGACATGGATATCAAG 120


5893R-2.IR_full       121 CGTGTGCTGCACTACTCCCAANAGCCTGGCANGCCATGGNCGGATCGCCCAATGGNACCC 180
                          ||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||| ||||
5893R-2.in silico     121 CGTGTGCTGCACTACTCCCAA-AGCCTGGCA-GCCATGGGCGGATCGCCCAATGG-ACCC 180


5893R-2.IR_full       181 GCCGGCCAGGGTGTGAACGGATCCTCGGGCATGGGTCACCACATGTCCAGTCACATGACC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5893R-2.in silico     181 GCCGGCCAGGGTGTGAACGGATCCTCGGGCATGGGTCACCACATGTCCAGTCACATGACC 240


5893R-2.IR_full       241 CCGCACCACATGCANCCAGGCGGTCTCCGCCCAACAGACCTTGTCGCCCAACAGTTCCAT 300
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
5893R-2.in silico     241 CCGCACCACATGCA-CCAGGCGGTCTCCGCCCAACAGACCTTGTCGCCCAACAGTTCCAT 300


5893R-2.IR_full       301 CGGATCCGCCGGCAGTCTGGGTAGCCAGAGCAGCCTGGGCAGCAATGGCAGTGGTCTCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5893R-2.in silico     301 CGGATCCGCCGGCAGTCTGGGTAGCCAGAGCAGCCTGGGCAGCAATGGCAGTGGTCTCAA 360


5893R-2.IR_full       361 CTCCAGTTCGGGTCACCAGTCCGCCGGCATGCACAGTTTGGCCACATCGCCGGGACAAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5893R-2.in silico     361 CTCCAGTTCGGGTCACCAGTCCGCCGGCATGCACAGTTTGGCCACATCGCCGGGACAAGA 420


5893R-2.IR_full       421 GGGTCACATCAAGCGTCCAATGAACGCGTTCATGGTCTGGTNCCCGCCTGCAGCGTCGTC 480
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
5893R-2.in silico     421 GGGTCACATCAAGCGTCCAATGAACGCGTTCATGGTCTGGT-CCCGCCTGCAGCGTCGTC 480


5893R-2.IR_full       481 AGATCGCCAAGGATAACCCCAAGAT 505
                          |||||||||||||||||||||||||
5893R-2.in silico     481 AGATCGCCAAGGATAACCCCAAGAT 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079342.2  CG5893-RA (D), mRNA 
0   11  NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   14  NM_140437.1  CG7345-RA (Sox21a), mRNA 
0   NM_079213.2  CG5486-RB, transcript variant B (Ubp64E), mRNA 
0   NM_206279.1  CG5486-RC, transcript variant C (Ubp64E), mRNA 
0   NM_168129.1  CG5486-RA, transcript variant A (Ubp64E), mRNA 
0   NM_079015.2  CG8404-RA (Sox15), mRNA 
0   NM_142839.1  CG4725-RA (CG4725), mRNA 
0   NM_166792.1  CG11153-RA, transcript variant A (Sox102F), mRNA 
0   NM_001014695.1  CG11153-RB, transcript variant B (Sox102F), mRNA 
0   NM_079378.2  CG5444-RA, transcript variant A (Taf4), mRNA 
0   NM_176333.1  CG5444-RC, transcript variant C (Taf4), mRNA 
0   NM_206379.1  CG5444-RD, transcript variant D (Taf4), mRNA 
0   NM_168651.1  CG5444-RB, transcript variant B (Taf4), mRNA 
0   NM_132092.2  CG3869-RA, transcript variant A (Marf), mRNA 
0   NM_206634.1  CG3869-RC, transcript variant C (Marf), mRNA 
0   NM_206635.2  CG3869-RB, transcript variant B (Marf), mRNA 
0   NM_206442.1  CG1030-RC, transcript variant C (Scr), mRNA 
0   NM_206443.1  CG1030-RB, transcript variant B (Scr), mRNA 
0   NM_079524.3  CG1030-RA, transcript variant A (Scr), mRNA 
0   NM_206469.1  CG11870-RD, transcript variant D (CG11870), mRNA 
0   NM_169337.2  CG11870-RB, transcript variant B (CG11870), mRNA 
0   NM_206470.1  CG11870-RC, transcript variant C (CG11870), mRNA 
0   NM_141734.2  CG11870-RA, transcript variant A (CG11870), mRNA 
0   NM_169763.1  CG5829-RA (CG5829), mRNA 
0   NM_144390.1  CG18744-RA (CG18744), mRNA 
0   NM_079945.2  CG4443-RA (crl), mRNA 
0   NM_206405.1  CG33286-RA (CG33286), mRNA 
0   NM_001043100.1  CG15661-RB, transcript variant B (CG15661), mRNA 
0   NM_137720.2  CG15661-RA, transcript variant A (CG15661), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.