National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5887R-4 
 Symbol desat1  Full Name desat1 
 CG No CG5887  Old CG No CG5887 
 Synonyms Fad, CG5887, fad, desat, l(3)S028813, unnamed, BEST:SD05462, anon-WO0118547.730, anon-WO0118547.726, desat1, Desat1 
 Accession No (Link to NCBI) NM_144474.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wicker-Thomas C, Guenachi I, Keita YF.
Contribution of oenocytes and pheromones to courtship behaviour in Drosophila.
BMC Biochem. (2009) 10 21 [ PubMed ID = 19671131 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACTCCACCGGAGTGCTCTTC 
 Primer Seq. 3'
aatctagaggtaccAGATCGACTCCCTTGCCCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACTCCACCG GAGTGCTCTT CGAGTGCGAT GTGGAAACCA CCGACGGTGG TCTTGTCAAG 
0061 GACATCACCG TGATGAAGAA GGCCGAGAAG CGCCGCCTGA AGCTCGTCTG GCGCAACATC 
0121 ATCGCCTTCG GTTACCTCCA TCTGGCTGCC CTCTACGGAG CCTACCTCAT GGTCACCTCT 
0181 GCCAAGTGGC AGACGTGCAT CTTAGCTTAT TTTCTATACG TCATTTCTGG CCTAGGCATT 
0241 ACCGCCGGTG CCCATCGTCT GTGGGCGCAT CGCTCCTACA AGGCCAAGTG GCCCCTGCGA 
0301 GTGATTCTGG TCATCTTCAA CACGATTGCC TTCCAGGATG CCGCCTACCA TTGGGCTCGC 
0361 GACCATCGCG TCCACCACAA ATACTCGGAG ACTGACGCCG ATCCCCACAA CGCCACGCGT 
0421 GGTTTCTTCT TCTCGCACGT CGGCTGGCTG CTGTGCAAGA AGCACCCGGA GGTGAAAGCC 
0481 AAGGGCAAGG GAGTCGATCT  
 in silico PCR Fragment
0001 GACTCCACCG GAGTGCTCTT CGAGTGCGAT GTGGAAACCA CCGACGGTGG TCTTGTCAAG 
0061 GACATCACCG TGATGAAGAA GGCCGAGAAG CGCCGCCTGA AGCTCGTCTG GCGCAACATC 
0121 ATCGCCTTCG GTTACCTCCA TCTGGCTGCC CTCTACGGAG CCTACCTCAT GGTCACCTCT 
0181 GCCAAGTGGC AGACGTGCAT CTTAGCTTAT TTTCTATACG TCATTTCTGG CCTAGGCATT 
0241 ACCGCCGGTG CCCATCGTCT GTGGGCGCAT CGCTCCTACA AGGCCAAGTG GCCCCTGCGA 
0301 GTGATTCTGG TCATCTTCAA CACGATTGCC TTCCAGGATG CCGCCTACCA TTGGGCTCGC 
0361 GACCATCGCG TCCACCACAA ATACTCGGAG ACTGACGCCG ATCCCCACAA CGCCACGCGT 
0421 GGTTTCTTCT TCTCGCACGT CGGCTGGCTG CTGTGCAAGA AGCACCCGGA GGTGAAAGCC 
0481 AAGGGCAAGG GAGTCGATCT  
 Assemble Data

5887R-4.IR_full       1   GACTCCACCGGAGTGCTCTTCGAGTGCGATGTGGAAACCACCGACGGTGGTCTTGTCAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     1   GACTCCACCGGAGTGCTCTTCGAGTGCGATGTGGAAACCACCGACGGTGGTCTTGTCAAG 60


5887R-4.IR_full       61  GACATCACCGTGATGAAGAAGGCCGAGAAGCGCCGCCTGAAGCTCGTCTGGCGCAACATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     61  GACATCACCGTGATGAAGAAGGCCGAGAAGCGCCGCCTGAAGCTCGTCTGGCGCAACATC 120


5887R-4.IR_full       121 ATCGCCTTCGGTTACCTCCATCTGGCTGCCCTCTACGGAGCCTACCTCATGGTCACCTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     121 ATCGCCTTCGGTTACCTCCATCTGGCTGCCCTCTACGGAGCCTACCTCATGGTCACCTCT 180


5887R-4.IR_full       181 GCCAAGTGGCAGACGTGCATCTTAGCTTATTTTCTATACGTCATTTCTGGCCTAGGCATT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     181 GCCAAGTGGCAGACGTGCATCTTAGCTTATTTTCTATACGTCATTTCTGGCCTAGGCATT 240


5887R-4.IR_full       241 ACCGCCGGTGCCCATCGTCTGTGGGCGCATCGCTCCTACAAGGCCAAGTGGCCCCTGCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     241 ACCGCCGGTGCCCATCGTCTGTGGGCGCATCGCTCCTACAAGGCCAAGTGGCCCCTGCGA 300


5887R-4.IR_full       301 GTGATTCTGGTCATCTTCAACACGATTGCCTTCCAGGATGCCGCCTACCATTGGGCTCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     301 GTGATTCTGGTCATCTTCAACACGATTGCCTTCCAGGATGCCGCCTACCATTGGGCTCGC 360


5887R-4.IR_full       361 GACCATCGCGTCCACCACAAATACTCGGAGACTGACGCCGATCCCCACAACGCCACGCGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     361 GACCATCGCGTCCACCACAAATACTCGGAGACTGACGCCGATCCCCACAACGCCACGCGT 420


5887R-4.IR_full       421 GGTTTCTTCTTCTCGCACGTCGGCTGGCTGCTGTGCAAGAAGCACCCGGAGGTGAAAGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5887R-4.in silico     421 GGTTTCTTCTTCTCGCACGTCGGCTGGCTGCTGTGCAAGAAGCACCCGGAGGTGAAAGCC 480


5887R-4.IR_full       481 AAGGGCAAGGGAGTCGATCT 500
                          ||||||||||||||||||||
5887R-4.in silico     481 AAGGGCAAGGGAGTCGATCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_144474.1  CG5887-RA, transcript variant A (desat1), mRNA 
100   482  NM_169466.1  CG5887-RC, transcript variant C (desat1), mRNA 
100   482  NM_169468.1  CG5887-RE, transcript variant E (desat1), mRNA 
100   482  NM_169465.1  CG5887-RB, transcript variant B (desat1), mRNA 
100   482  NM_169467.1  CG5887-RD, transcript variant D (desat1), mRNA 
3.73   18  46  69  53  NM_141944.1  CG5925-RA (desat2), mRNA 
0   11  19  25  NM_169500.1  CG8630-RA (CG8630), mRNA 
0   20  31  NM_143709.2  CG7923-RA (Fad2), mRNA 
0   20  43  NM_143522.2  CG9747-RA (CG9747), mRNA 
0   21  30  NM_143524.2  CG9743-RA (CG9743), mRNA 
0   NM_144274.2  CG11368-RA (CG11368), mRNA 
0   NM_165891.1  CG30045-RA (CG30045), mRNA 
0   NM_170360.1  CG4976-RA (Mes-4), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_137190.2  CG8174-RB, transcript variant B (SRPK), mRNA 
0   NM_166093.1  CG8174-RA, transcript variant A (SRPK), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_166094.1  CG8174-RC, transcript variant C (SRPK), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   13  NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_080004.2  CG6939-RB, transcript variant B (Sbf), mRNA, ankyrin repeat, tyrosine kinase CG18247-RA (shark), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.