National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5887R-1 
 Symbol desat1  Full Name desat1 
 CG No CG5887  Old CG No CG5887 
 Synonyms Fad, CG5887, fad, desat, l(3)S028813, unnamed, BEST:SD05462, anon-WO0118547.730, anon-WO0118547.726, desat1, Desat1 
 Accession No (Link to NCBI) NM_144474.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Wicker-Thomas C, Guenachi I, Keita YF.
Contribution of oenocytes and pheromones to courtship behaviour in Drosophila.
BMC Biochem. (2009) 10 21 [ PubMed ID = 19671131 ] [ RRC reference ]

Chew SK, Chen P, Link N, Galindo KA, Pogue K, Abrams JM.
Genome-wide silencing in Drosophila captures conserved apoptotic effectors.
Nature (2009) 460(7251) 123-7 [ PubMed ID = 19483676 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GACTCCACCGGAGTGCTCTTCGAGTGCGATGTGGAAACCACCGACGGTGGTCTTGTCAAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACATCACCGTGATGAAGAAGGCCGAGAAGCGCCGCCTGAAGCTCGTCTGGCGCAACATC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCGCCTTCGGTTACCTCCATCTGGCTGCCCTCTACGGAGCCTACCTCATGGTCACCTCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCAAGTGGCAGACGTGCATCTTAGCTTATTTTCTATACGTCATTTCTGGCCTAGGCATT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCGCCGGTGCCCATCGTCTGTGGGCGCATCGCTCCTACAAGGCCAAGTGGCCCCTGCGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTGATTCTGGTCATCTTCAACACGATTGCCTTCCAGGATGCCGCCTACCATTGGGCTCGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACCATCGCGTCCACCACAAATACTCGGAGACTGACGCCGATCCCCACAACGCCACGCGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGTTTCTTCTTCTCGCACGTCGGCTGGCTGCTGTGCAAGAAGCACCCGGAGGTGAAAGCC 480

5887R-1.IR_full       481 AAGGGCAAGGGAGTCGATCT 500
                          |||||||||||||||||||| silico     481 AAGGGCAAGGGAGTCGATCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_144474.1  CG5887-RA, transcript variant A (desat1), mRNA 
100   482  NM_169466.1  CG5887-RC, transcript variant C (desat1), mRNA 
100   482  NM_169468.1  CG5887-RE, transcript variant E (desat1), mRNA 
100   482  NM_169465.1  CG5887-RB, transcript variant B (desat1), mRNA 
100   482  NM_169467.1  CG5887-RD, transcript variant D (desat1), mRNA 
3.73   18  46  69  53  NM_141944.1  CG5925-RA (desat2), mRNA 
0   11  19  25  NM_169500.1  CG8630-RA (CG8630), mRNA 
0   20  31  NM_143709.2  CG7923-RA (Fad2), mRNA 
0   20  43  NM_143522.2  CG9747-RA (CG9747), mRNA 
0   21  30  NM_143524.2  CG9743-RA (CG9743), mRNA 
0   NM_144274.2  CG11368-RA (CG11368), mRNA 
0   NM_165891.1  CG30045-RA (CG30045), mRNA 
0   NM_170360.1  CG4976-RA (Mes-4), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_137190.2  CG8174-RB, transcript variant B (SRPK), mRNA 
0   NM_166093.1  CG8174-RA, transcript variant A (SRPK), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_166094.1  CG8174-RC, transcript variant C (SRPK), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   13  NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_080004.2  CG6939-RB, transcript variant B (Sbf), mRNA, ankyrin repeat, tyrosine kinase CG18247-RA (shark), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.