National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5876R-1 
 Symbol heix  Full Name heixuedian 
 CG No CG5876  Old CG No CG5876 
 Synonyms l(2)35Fc, ipa-6d, BG:DS02740.7, 124/1, l(2)k12401, CG5876, heix 
 Accession No (Link to NCBI) NM_078857.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCCAGGAATGGCAAGACCAA 
 Primer Seq. 3'
aatctagaggtaccTCAGTGCCAGGTGCTCCATTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCCAGGAAT GGCAAGACCA AGACAGAGGA CGGTGAGGAG GTGGAAGCCG TTGTTGGAGC 
0061 TCGTGCAGCA GGTGCAGATG CCGGAGTAGC ACTAACGGGA CGACTAACAG GACACCCATC 
0121 CACATCCGGA ACGTTTATGA AACTGAAAAC CTATCTCCTA GCTCTGCGTC CCTGGTCGCT 
0181 GTCCGCCAGT CTGGTTCCAA CGCTGCTCGG CTCAGCCCTG GCCTACCGCT CCCAGTGGGC 
0241 GGAGGAGTTT TCGCTGGCCA CCTTCTTTCT CACCGCCTTC ACCGTGGTCA CCGTCCACTG 
0301 CGCCGGCAAC GTAGTTAACA CCTATTTCGA CTTCATCAAG GGCATTGACA AGCAGAAAGC 
0361 CGACGACCGC ACGCTGGTGG ATCACATACT CACCAAGGAT GAGGTGGTAT CGCTGGGTGC 
0421 CATTCTGTAC ATGGCTGGCT GTGGAGGATT TGTTTTGCTG GCTGTGCTCA GTCCGGCGAA 
0481 AATGGAGCAC CTGGCACTGA  
 in silico PCR Fragment
0001 GTCCAGGAAT GGCAAGACCA AGACAGAGGA CGGTGAGGAG GTGGAAGCCG TTGTTGGAGC 
0061 TCGTGCAGCA GGTGCAGATG CCGGAGTAGC ACTAACGGGA CGACTAACAG GACACCCATC 
0121 CACATCCGGA ACGTTTATGA AACTGAAAAC CTATCTCCTA GCTCTGCGTC CCTGGTCGCT 
0181 GTCCGCCAGT CTGGTTCCAA CGCTGCTCGG CTCAGCCCTG GCCTACCGCT CCCAGTGGGC 
0241 GGAGGAGTTT TCGCTGGCCA CCTTCTTTCT CACCGCCTTC ACCGTGGTCA CCGTCCACTG 
0301 CGCCGGCAAC GTAGTTAACA CCTATTTCGA CTTCATCAAG GGCATTGACA AGCAGAAAGC 
0361 CGACGACCGC ACGCTGGTGG ATCACATACT CACCAAGGAT GAGGTGGTAT CGCTGGGTGC 
0421 CATTCTGTAC ATGGCTGGCT GTGGAGGATT TGTTTTGCTG GCTGTGCTCA GTCCGGCGAA 
0481 AATGGAGCAC CTGGCACTGA  
 Assemble Data

5876R-1.IR_full       1   GTCCAGGAATGGCAAGACCAAGACAGAGGACGGTGAGGAGGTGGAAGCCGTTGTTGGAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     1   GTCCAGGAATGGCAAGACCAAGACAGAGGACGGTGAGGAGGTGGAAGCCGTTGTTGGAGC 60


5876R-1.IR_full       61  TCGTGCAGCAGGTGCAGATGCCGGAGTAGCACTAACGGGACGACTAACAGGACACCCATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     61  TCGTGCAGCAGGTGCAGATGCCGGAGTAGCACTAACGGGACGACTAACAGGACACCCATC 120


5876R-1.IR_full       121 CACATCCGGAACGTTTATGAAACTGAAAACCTATCTCCTAGCTCTGCGTCCCTGGTCGCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     121 CACATCCGGAACGTTTATGAAACTGAAAACCTATCTCCTAGCTCTGCGTCCCTGGTCGCT 180


5876R-1.IR_full       181 GTCCGCCAGTCTGGTTCCAACGCTGCTCGGCTCAGCCCTGGCCTACCGCTCCCAGTGGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     181 GTCCGCCAGTCTGGTTCCAACGCTGCTCGGCTCAGCCCTGGCCTACCGCTCCCAGTGGGC 240


5876R-1.IR_full       241 GGAGGAGTTTTCGCTGGCCACCTTCTTTCTCACCGCCTTCACCGTGGTCACCGTCCACTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     241 GGAGGAGTTTTCGCTGGCCACCTTCTTTCTCACCGCCTTCACCGTGGTCACCGTCCACTG 300


5876R-1.IR_full       301 CGCCGGCAACGTAGTTAACACCTATTTCGACTTCATCAAGGGCATTGACAAGCAGAAAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     301 CGCCGGCAACGTAGTTAACACCTATTTCGACTTCATCAAGGGCATTGACAAGCAGAAAGC 360


5876R-1.IR_full       361 CGACGACCGCACGCTGGTGGATCACATACTCACCAAGGATGAGGTGGTATCGCTGGGTGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     361 CGACGACCGCACGCTGGTGGATCACATACTCACCAAGGATGAGGTGGTATCGCTGGGTGC 420


5876R-1.IR_full       421 CATTCTGTACATGGCTGGCTGTGGAGGATTTGTTTTGCTGGCTGTGCTCAGTCCGGCGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5876R-1.in silico     421 CATTCTGTACATGGCTGGCTGTGGAGGATTTGTTTTGCTGGCTGTGCTCAGTCCGGCGAA 480


5876R-1.IR_full       481 AATGGAGCACCTGGCACTGA 500
                          ||||||||||||||||||||
5876R-1.in silico     481 AATGGAGCACCTGGCACTGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078857.2  CG5876-RA (heix), mRNA 
0.41   NM_169758.1  CG5407-RA, transcript variant A (Sur-8), mRNA 
0.41   NM_142363.4  CG5407-RB, transcript variant B (Sur-8), mRNA 
0   NM_205957.1  CG33304-RA (rho-5), mRNA 
0   NM_168235.1  CG17888-RB, transcript variant B (Pdp1), mRNA 
0   NM_168236.1  CG17888-RG, transcript variant G (Pdp1), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_142395.1  CG7431-RA (CG7431), mRNA 
0   NM_135833.2  CG16865-RA (CG16865), mRNA 
0   NM_136687.2  CG1472-RA (sec24), mRNA 
0   NM_133103.2  CG7280-RA (CG7280), mRNA 
0   NM_142246.2  CG4225-RA (CG4225), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_133156.1  CG12202-RA (Nat1), mRNA 
0   NM_141376.2  CG15594-RA, transcript variant A (CG15594), mRNA 
0   NM_206259.1  CG1271-RC, transcript variant C (CG1271), mRNA 
0   NM_167973.1  CG1271-RD, transcript variant D (CG1271), mRNA 
0   NM_139506.2  CG1271-RA, transcript variant A (CG1271), mRNA 
0   NM_167974.1  CG1271-RB, transcript variant B (CG1271), mRNA 
0   NM_168282.1  CG32351-RA (CG32351), mRNA 
0   NM_139401.1  CG13933-RA (CG13933), mRNA 
0   NM_169921.1  CG31203-RE, transcript variant E (CG31203), mRNA 
0   NM_169920.1  CG31203-RD, transcript variant D (CG31203), mRNA 
0   NM_169918.1  CG31203-RA, transcript variant A (CG31203), mRNA 
0   NM_169919.1  CG31203-RB, transcript variant B (CG31203), mRNA 
0   NM_169922.1  CG31203-RC, transcript variant C (CG31203), mRNA 
0   14  NM_206407.1  CG32434-RA, transcript variant A (siz), mRNA 
0   11  NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   11  NM_001043153.1  CG32434-RC, transcript variant C (siz), mRNA 
0   10  NM_133045.2  CG15064-RA (Him), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.