National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5854R-4 
 Symbol CG5854  Full Name CG5854 
 CG No CG5854  Old CG No CG5854 
 Synonyms anon-WO0118547.306, CG5854 
 Accession No (Link to NCBI) NM_142939.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TCTGAAAAGCCGACTGTTCTGATTTTGGGTGGCTGCGGCTTCATTGGACGCAACTTGGC 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CACTTATCTGCTGGACAATGAACTGGCGCAGGAAATACGACTGGCCGATAAGACCCCTCC 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCAGATGGCATGGCTAAACGAGGAGCAGACGCGGGTCTTCGAGAGCGATCGGGTGGAGTT 179

                          ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| | silico     181 CTGCAGCGCGAACCTAATAAACGCCGCCTCATGCAA-GGCGGCTTTTGCGCCACACCC-C 239

                          |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCACTGGACGGGCCTGGGACATTGTCATCAATTGTGCGGCCGAGACGCGTGCCAACCAG 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATGATGCCGTATACAAGGAGGGTATCCTGAAGCTCAGTTTGAACTGCGCCAATGAGGCG 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTAACCAGCGGGTCAAACGATACGTGGAACTCAGCTCTGGTTGTGTGAACAGCAGCGAA 419

                          |||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||| silico     421 AAGACGCCGTTAAAAGAGGACTGCAAGACGGATCCCTGGACGGGCGTGGCCAAGCAGAAG 479

5854R-4.IR_full       481 CTCAAGGTGGAGAAGGAACTGG 501
                          |||||||||||||||||||||| silico     481 CTCAAGGTGGAGAAGGAACTGG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   592  NM_170099.1  CG5854-RB, transcript variant B (CG5854), mRNA 
78.71   466  NM_142939.1  CG5854-RA, transcript variant A (CG5854), mRNA 
0.33   NM_142857.2  CG17121-RA (CG17121), mRNA 
0.16   13  NM_079001.2  CG3886-RA (Psc), mRNA 
0.16   NM_001043127.1  CG34121-RA (CG34121), mRNA 
0   13  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_134938.2  CG3238-RA (CG3238), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 
0   NM_132109.1  CG3198-RA (CG3198), mRNA 
0   11  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   10  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   10  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 
0   NM_132650.1  CG10617-RA (CG10617), mRNA 
0   14  NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_079558.4  CG31453-RA (CG31453), mRNA 
0   13  NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0   NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0   NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_134735.1  CG4785-RA (CG4785), mRNA 
0   NM_176737.1  CG9213-RA (CG9213), mRNA 
0   28  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
0   NM_165746.1  CG4001-RB, transcript variant B (Pfk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.