National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5854R-2 
 Symbol CG5854  Full Name CG5854 
 CG No CG5854  Old CG No CG5854 
 Synonyms anon-WO0118547.306, CG5854 
 Accession No (Link to NCBI) NM_142939.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCTGAAAAGCCGACTGTTCT 
 Primer Seq. 3'
aatctagaggtaccCCAGTTCCTTCTCCACCTTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCTGAAAAG CCGACTGTTC TGATTTTGGG TGGCTGCGGC TTCATTGGAC GCAACTTGGC 
0061 CACTTATCTG CTGGACAATG AACTGGCGCA GGAAATACGA CTGGCCGATA AGACCCCTCC 
0121 GCAGATGGCA TGGCTAAACG AGGAGCAGAC GCGGGTCTTC GAGAGCGATC GGGTGGAGTT 
0181 CTGCAGCGCT AACCTAATAA ACGCCGCCTC ATGCAANGGC GGCTTTTGCG CCACACCCNC 
0241 ACCACTGGCC GGGCCTGGGA CATTGTCATC AATTGTGCGG CCGAGACGCG TGCCAACCAG 
0301 GATGATGCCG TATACAAGGA GGGTATCCTG AAGCTCAGTT TGAACTGCGC CAATGAGGCG 
0361 GCTAACCAGC GGGTCAAACG ATACGTGGAA CTCAGCTCTG GTTGTGTGAA CAGCAGCGAA 
0421 AAGACGCCGT TAAAAGNGGA CTGCAAGANG GANCCCTGGA CgGGCGTgGC CAAGCAGAAG 
0481 CTCAAGGTGG AGAAGGAACT GG 
 in silico PCR Fragment
0001 GTCTGAAAAG CCGACTGTTC TGATTTTGGG TGGCTGCGGC TTCATTGGAC GCAACTTGGC 
0061 CACTTATCTG CTGGACAATG AACTGGCGCA GGAAATACGA CTGGCCGATA AGACCCCTCC 
0121 GCAGATGGCA TGGCTAAACG AGGAGCAGAC GCGGGTCTTC GAGAGCGATC GGGTGGAGTT 
0181 CTGCAGCGCG AACCTAATAA ACGCCGCCTC ATGCAA-GGC GGCTTTTGCG CCACACCC-C 
0241 ACCACTGGAC GGGCCTGGGA CATTGTCATC AATTGTGCGG CCGAGACGCG TGCCAACCAG 
0301 GATGATGCCG TATACAAGGA GGGTATCCTG AAGCTCAGTT TGAACTGCGC CAATGAGGCG 
0361 GCTAACCAGC GGGTCAAACG ATACGTGGAA CTCAGCTCTG GTTGTGTGAA CAGCAGCGAA 
0421 AAGACGCCGT TAAAAGAGGA CTGCAAGACG GATCCCTGGA CGGGCGTGGC CAAGCAGAAG 
0481 CTCAAGGTGG AGAAGGAACT GG 
 Assemble Data

5854R-2.IR_full        1   TCTGAAAAGCCGACTGTTCTGATTTTGGGTGGCTGCGGCTTCATTGGACGCAACTTGGC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5854R-2.in silico      1   TCTGAAAAGCCGACTGTTCTGATTTTGGGTGGCTGCGGCTTCATTGGACGCAACTTGGC 59


5854R-2.IR_full       61  CACTTATCTGCTGGACAATGAACTGGCGCAGGAAATACGACTGGCCGATAAGACCCCTCC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5854R-2.in silico     61  CACTTATCTGCTGGACAATGAACTGGCGCAGGAAATACGACTGGCCGATAAGACCCCTCC 119


5854R-2.IR_full       121 GCAGATGGCATGGCTAAACGAGGAGCAGACGCGGGTCTTCGAGAGCGATCGGGTGGAGTT 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5854R-2.in silico     121 GCAGATGGCATGGCTAAACGAGGAGCAGACGCGGGTCTTCGAGAGCGATCGGGTGGAGTT 179


5854R-2.IR_full       181 CTGCAGCGCTAACCTAATAAACGCCGCCTCATGCAANGGCGGCTTTTGCGCCACACCCNC 239
                          ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
5854R-2.in silico     181 CTGCAGCGCGAACCTAATAAACGCCGCCTCATGCAA-GGCGGCTTTTGCGCCACACCC-C 239


5854R-2.IR_full       241 ACCACTGGCCGGGCCTGGGACATTGTCATCAATTGTGCGGCCGAGACGCGTGCCAACCAG 299
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
5854R-2.in silico     241 ACCACTGGACGGGCCTGGGACATTGTCATCAATTGTGCGGCCGAGACGCGTGCCAACCAG 299


5854R-2.IR_full       301 GATGATGCCGTATACAAGGAGGGTATCCTGAAGCTCAGTTTGAACTGCGCCAATGAGGCG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5854R-2.in silico     301 GATGATGCCGTATACAAGGAGGGTATCCTGAAGCTCAGTTTGAACTGCGCCAATGAGGCG 359


5854R-2.IR_full       361 GCTAACCAGCGGGTCAAACGATACGTGGAACTCAGCTCTGGTTGTGTGAACAGCAGCGAA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5854R-2.in silico     361 GCTAACCAGCGGGTCAAACGATACGTGGAACTCAGCTCTGGTTGTGTGAACAGCAGCGAA 419


5854R-2.IR_full       421 AAGACGCCGTTAAAAGNGGACTGCAAGANGGANCCCTGGACGGGCGTGGCCAAGCAGAAG 479
                          |||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||
5854R-2.in silico     421 AAGACGCCGTTAAAAGAGGACTGCAAGACGGATCCCTGGACGGGCGTGGCCAAGCAGAAG 479


5854R-2.IR_full       481 CTCAAGGTGGAGAAGGAACTGG 501
                          ||||||||||||||||||||||
5854R-2.in silico     481 CTCAAGGTGGAGAAGGAACTGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   592  NM_170099.1  CG5854-RB, transcript variant B (CG5854), mRNA 
78.71   466  NM_142939.1  CG5854-RA, transcript variant A (CG5854), mRNA 
0.33   NM_142857.2  CG17121-RA (CG17121), mRNA 
0.16   13  NM_079001.2  CG3886-RA (Psc), mRNA 
0.16   NM_001043127.1  CG34121-RA (CG34121), mRNA 
0   13  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_134938.2  CG3238-RA (CG3238), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 
0   NM_132109.1  CG3198-RA (CG3198), mRNA 
0   11  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   10  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   10  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 
0   NM_132650.1  CG10617-RA (CG10617), mRNA 
0   14  NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_079558.4  CG31453-RA (CG31453), mRNA 
0   13  NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0   NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0   NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_134735.1  CG4785-RA (CG4785), mRNA 
0   NM_176737.1  CG9213-RA (CG9213), mRNA 
0   28  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
0   NM_165746.1  CG4001-RB, transcript variant B (Pfk), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.