National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5790R-1 
 Symbol CG5790  Full Name CG5790 
 CG No CG5790  Old CG No CG5790 
 Synonyms CG5790 
 Accession No (Link to NCBI) NM_136032.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAAAGGTTCGTTCCGATGGCATCCGGAACTATGCCTTCCGTTTCGGGCACTAACCATCAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCTAGGCATCAACAGCTCCTTCTCCAACAAGCTCCCAAGTGCACTGCCGATCTCAACGAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAATTAGTAAAAATCAATCGGCAAAACGCCAATAAGGAGCTATCCACCATTCAGGCAAAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GATATGCAATCCGTTGATAAAAACGAAGAGGCCCTAAAAGAATTGCAGGAGAGCATTCCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAAATCAACAAAATCTTCGATGTGCACTGTCGCATCGGCAGTGGAACCTTCAGCACAGTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTCTTGGGAACCCTGCAGCGGGAAAGGGGTCTCGTGGAAACCCAAAGGAGGAGATTCGCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATCAAACATCATAATCCCACAAATCATCCGGAGAGGATTCTTAGAGAGTTGGAGTGCATG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TATCGCATTGGTGGAGTGGAAAATGTAATCGGAATTAATTGCTGCATTAGATATAACGAC 480

5790R-1.IR_full       481 AACGTGGCCTTTATCATGCC 500
                          |||||||||||||||||||| silico     481 AACGTGGCCTTTATCATGCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136032.2  CG5790-RA (CG5790), mRNA 
0   NM_137697.2  CG9353-RA (mRpL54), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_078868.2  CG5545-RA (Oli), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_132758.1  CG9504-RA (Eo), mRNA 
0   NM_136458.2  CG30494-RA (CG30494), mRNA 
0   NM_132301.3  CG7065-RA (CG7065), mRNA 
0   NM_079490.2  CG5837-RA (Hem), mRNA 
0   NM_137918.2  CG12192-RA (Klp59D), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   11  NM_169023.1  CG31536-RB, transcript variant B (Cdep), mRNA 
0   11  NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   11  NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   10  NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_132944.2  CG13003-RA (CG13003), mRNA 
0   NM_206754.1  CG9177-RG, transcript variant G (eIF5), mRNA 
0   NM_167477.1  CG9177-RA, transcript variant A (eIF5), mRNA 
0   NM_132870.3  CG9177-RB, transcript variant B (eIF5), mRNA 
0   NM_206758.1  CG9177-RC, transcript variant C (eIF5), mRNA 
0   NM_135990.2  CG6860-RB, transcript variant B (CG6860), mRNA 
0   NM_001014479.1  CG33529-RB, transcript variant B (Rapgap1), mRNA 
0   NM_001014478.1  CG33529-RA, transcript variant A (Rapgap1), mRNA 
0   NM_165212.1  CG6860-RA, transcript variant A (CG6860), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.