National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5742R-3 
 Symbol CG5742  Full Name CG5742 
 CG No CG5742  Old CG No CG5742 
 Synonyms CG5742 
 Accession No (Link to NCBI) NM_137451.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGGACGAGTGCGACAAGC 
 Primer Seq. 3'
aatctagaggtaccCACCTGGGTGATTGTCTGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGGACGA GTGCGACAAG CACAAACAGC AGGCGACgGC GGACGCCAAG TCCACGTcNA 
0061 GCGAGGATTC CGATGAGTAC CAATCGGCCG GTGAgGGCGA GNGGATGGAG ACGGCGATGG 
0121 TGACGGTGAT TCCCCAGCGG AgCGCCCGCC TGACAAAACC AGCCCCACGG TCGCCGTTGC 
0181 GCCCACAGCA AAGGCAGCAT CGCCACTGCC CACTGTGAAG CCAGCATCCG AGGCCCTGGA 
0241 CTTTCCTATG CACCGGAGTG TTTTCGAGGA CGACATNCAA GTCGCTGCAG CGACGACTTC 
0301 TATTGAGCAC GGCCCAAGAC GAAGTGGGTA GAAAGGATAA GCACGGCAAT ACGCCACTCC 
0361 ATCTGGCCGT AATGCTGGGC AGAAAGCACG CTGTCCGTTT GCTTCTGGCC CAAAACGCCC 
0421 CCGTAAAGAT CAAGAACAAT GAGGGCTGGT CCCCGCTGTC CGAGGCCATT AGCTACgGNG 
0481 ACCGCCAGAC AATCACCCAG GTG 
 in silico PCR Fragment
0001 AGGAGGACGA GTGCGACAAG CACAAACAGC AGGCGACGGC GGACGCCAAG TCCACGTCGA 
0061 GCGAGGATTC CGATGAGTAC CAATCGGCCG GTGAGGGCGA --GGATGGAG ACGGCGATGG 
0121 TGACGGTGAT TCCCCAGCGG AGCGCCCGCC TGACAAAACC AGCCCCACGG TCGCCGTTGC 
0181 GCCCACAGCA AAGGCAGCAT CGCCACTGCC CACTGTGAAG CCAGCATCCG AGGCCCTGGA 
0241 CTTTCCTATG CACCGGAGTG TTTTCGAGGA CGACAT-CAA GTCGCTGCAG CGACGACTTC 
0301 TATTGAGCAC GGCCCAAGAC GAAGTGGGTA GAAAGGATAA GCACGGCAAT ACGCCACTCC 
0361 ATCTGGCCGT AATGCTGGGC AGAAAGCACG CTGTCCGTTT GCTTCTGGCC CAAAACGCCC 
0421 CCGTAAAGAT CAAGAACAAT GAGGGCTGGT CCCCGCTGTC CGAGGCCATT AGCTACGGCG 
0481 ACCGCCAGAC AATCACCCAG GTG 
 Assemble Data

5742R-3.IR_full       1   AGGAGGACGAGTGCGACAAGCACAAACAGCAGGCGACGGCGGACGCCAAGTCCACGTCNA 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
5742R-3.in silico     1   AGGAGGACGAGTGCGACAAGCACAAACAGCAGGCGACGGCGGACGCCAAGTCCACGTCGA 60


5742R-3.IR_full       61  GCGAGGATTCCGATGAGTACCAATCGGCCGGTGAGGGCGAGNGGATGGAGACGGCGATGG 120
                          ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
5742R-3.in silico     61  GCGAGGATTCCGATGAGTACCAATCGGCCGGTGAGGGCGA--GGATGGAGACGGCGATGG 120


5742R-3.IR_full       121 TGACGGTGATTCCCCAGCGGAGCGCCCGCCTGACAAAACCAGCCCCACGGTCGCCGTTGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5742R-3.in silico     121 TGACGGTGATTCCCCAGCGGAGCGCCCGCCTGACAAAACCAGCCCCACGGTCGCCGTTGC 180


5742R-3.IR_full       181 GCCCACAGCAAAGGCAGCATCGCCACTGCCCACTGTGAAGCCAGCATCCGAGGCCCTGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5742R-3.in silico     181 GCCCACAGCAAAGGCAGCATCGCCACTGCCCACTGTGAAGCCAGCATCCGAGGCCCTGGA 240


5742R-3.IR_full       241 CTTTCCTATGCACCGGAGTGTTTTCGAGGACGACATNCAAGTCGCTGCAGCGACGACTTC 300
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
5742R-3.in silico     241 CTTTCCTATGCACCGGAGTGTTTTCGAGGACGACAT-CAAGTCGCTGCAGCGACGACTTC 300


5742R-3.IR_full       301 TATTGAGCACGGCCCAAGACGAAGTGGGTAGAAAGGATAAGCACGGCAATACGCCACTCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5742R-3.in silico     301 TATTGAGCACGGCCCAAGACGAAGTGGGTAGAAAGGATAAGCACGGCAATACGCCACTCC 360


5742R-3.IR_full       361 ATCTGGCCGTAATGCTGGGCAGAAAGCACGCTGTCCGTTTGCTTCTGGCCCAAAACGCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5742R-3.in silico     361 ATCTGGCCGTAATGCTGGGCAGAAAGCACGCTGTCCGTTTGCTTCTGGCCCAAAACGCCC 420


5742R-3.IR_full       421 CCGTAAAGATCAAGAACAATGAGGGCTGGTCCCCGCTGTCCGAGGCCATTAGCTACGGNG 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
5742R-3.in silico     421 CCGTAAAGATCAAGAACAATGAGGGCTGGTCCCCGCTGTCCGAGGCCATTAGCTACGGCG 480


5742R-3.IR_full       481 ACCGCCAGACAATCACCCAGGTG 503
                          |||||||||||||||||||||||
5742R-3.in silico     481 ACCGCCAGACAATCACCCAGGTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137451.2  CG5742-RA (CG5742), mRNA 
0.2   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_142158.1  CG6966-RA (CG6966), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_079128.2  CG4859-RB, transcript variant B (Mmp1), mRNA 
0   NM_166683.1  CG4859-RA, transcript variant A (Mmp1), mRNA 
0   NM_139523.1  CG12734-RA, transcript variant A (CG12734), mRNA 
0   NM_206262.1  CG12734-RB, transcript variant B (CG12734), mRNA 
0   NM_079321.2  CG10571-RA (ara), mRNA 
0   NM_140108.1  CG10809-RA (CG10809), mRNA 
0   NM_141917.1  CG4066-RA (CG4066), mRNA 
0   NM_132294.2  CG32707-RA (APC4), mRNA 
0   NM_136913.2  CG17739-RA (CG17739), mRNA 
0   NM_168420.1  CG32067-RA, transcript variant A (simj), mRNA 
0   NM_140150.2  CG32067-RC, transcript variant C (simj), mRNA 
0   NM_168421.1  CG32067-RB, transcript variant B (simj), mRNA 
0   NM_139666.1  CG7514-RA (CG7514), mRNA 
0   NM_170091.1  CG10217-RB, transcript variant B (CG10217), mRNA 
0   NM_142925.1  CG10217-RA, transcript variant A (CG10217), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_137056.2  CG13340-RA (CG13340), mRNA 
0   NM_168227.2  CG7462-RB, transcript variant B (Ank2), mRNA 
0   NM_139891.3  CG7462-RC, transcript variant C (Ank2), mRNA 
0   NM_135286.1  CG6739-RA (CG6739), mRNA 
0   NM_164354.1  CG31973-RB, transcript variant B (CG31973), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_168070.1  CG15009-RC, transcript variant C (ImpL2), mRNA 
0   NM_168069.1  CG15009-RB, transcript variant B (ImpL2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.