National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5742R-2 
 Symbol CG5742  Full Name CG5742 
 CG No CG5742  Old CG No CG5742 
 Synonyms CG5742 
 Accession No (Link to NCBI) NM_137451.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     1   AGGAGGACGAGTGCGACAAGCACAAACAGCAGGCGACGGCGGACGCCAAGTCCACGTCGA 60

                          ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| silico     61  GCGAGGATTCCGATGAGTACCAATCGGCCGGTGAGGGCGA--GGATGGAGACGGCGATGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGACGGTGATTCCCCAGCGGAGCGCCCGCCTGACAAAACCAGCCCCACGGTCGCCGTTGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCCACAGCAAAGGCAGCATCGCCACTGCCCACTGTGAAGCCAGCATCCGAGGCCCTGGA 240

                          |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     241 CTTTCCTATGCACCGGAGTGTTTTCGAGGACGACAT-CAAGTCGCTGCAGCGACGACTTC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATTGAGCACGGCCCAAGACGAAGTGGGTAGAAAGGATAAGCACGGCAATACGCCACTCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATCTGGCCGTAATGCTGGGCAGAAAGCACGCTGTCCGTTTGCTTCTGGCCCAAAACGCCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     421 CCGTAAAGATCAAGAACAATGAGGGCTGGTCCCCGCTGTCCGAGGCCATTAGCTACGGCG 480

5742R-2.IR_full       481 ACCGCCAGACAATCACCCAGGTG 503
                          ||||||||||||||||||||||| silico     481 ACCGCCAGACAATCACCCAGGTG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137451.2  CG5742-RA (CG5742), mRNA 
0.2   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_142158.1  CG6966-RA (CG6966), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_079128.2  CG4859-RB, transcript variant B (Mmp1), mRNA 
0   NM_166683.1  CG4859-RA, transcript variant A (Mmp1), mRNA 
0   NM_139523.1  CG12734-RA, transcript variant A (CG12734), mRNA 
0   NM_206262.1  CG12734-RB, transcript variant B (CG12734), mRNA 
0   NM_079321.2  CG10571-RA (ara), mRNA 
0   NM_140108.1  CG10809-RA (CG10809), mRNA 
0   NM_141917.1  CG4066-RA (CG4066), mRNA 
0   NM_132294.2  CG32707-RA (APC4), mRNA 
0   NM_136913.2  CG17739-RA (CG17739), mRNA 
0   NM_168420.1  CG32067-RA, transcript variant A (simj), mRNA 
0   NM_140150.2  CG32067-RC, transcript variant C (simj), mRNA 
0   NM_168421.1  CG32067-RB, transcript variant B (simj), mRNA 
0   NM_139666.1  CG7514-RA (CG7514), mRNA 
0   NM_170091.1  CG10217-RB, transcript variant B (CG10217), mRNA 
0   NM_142925.1  CG10217-RA, transcript variant A (CG10217), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_137056.2  CG13340-RA (CG13340), mRNA 
0   NM_168227.2  CG7462-RB, transcript variant B (Ank2), mRNA 
0   NM_139891.3  CG7462-RC, transcript variant C (Ank2), mRNA 
0   NM_135286.1  CG6739-RA (CG6739), mRNA 
0   NM_164354.1  CG31973-RB, transcript variant B (CG31973), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_168070.1  CG15009-RC, transcript variant C (ImpL2), mRNA 
0   NM_168069.1  CG15009-RB, transcript variant B (ImpL2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.