National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5641R-3 
 Symbol CG5641  Full Name CG5641 
 CG No CG5641  Old CG No CG5641 
 Synonyms CG5641 
 Accession No (Link to NCBI) NM_141939.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male pupal lethal, female semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCCTCGCGGAGGTCTTCTTT 
 Primer Seq. 3'
aatctagaggtaccTGGATCTCAGGCTCCAGCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 DCCCTCGCGG AGGTCTTCTT TCCCAAAGTT CCATCCGCCG GCGCCGTTGA CGATTCTGCT 
0061 TTGACTGCGG CGCTGCTGAA GCGTAACCAG GACCTGAGTC CCACTCCCAG CGAGCAGACG 
0121 GCTATTGGCA ATCTAGTGAC CAAGGTGCAG GCTGTTCTCG ACAATCTGGT GGTTGCACCC 
0181 GGGGATCTGA CAACTTGTCA ACTGGAGGAA GTGCGTCAGG TTGGCTCCTT CAAGAAGGGC 
0241 ACCATACTGA CGGGCAACAA TGTAGCCGAT GTGGTGGTTA TCCTCAAAAC CCTGCCCACC 
0301 AAGGAGGCCG TCGATGCGCT GGCCAAAAAA GTGGAGGCCG ACCTGAAGGC CAGCATGAAG 
0361 ACTGAAGTTC TGACCAAGGG CGATCAGCAC ACCGTACAGA TCCATGAGCG GGGCTTCGAC 
0421 ATCGCCAACG TGCATGCCAA GGTGCGCATT CTGATCGCCA CCTTGCCGCA GAATCTTCGC 
0481 AAGCTGGAGC CTGAGATCCA  
 in silico PCR Fragment
0001 ACCCTCGCGG AGGTCTTCTT TCCCAAAGTT CCATCCGCCG GCGCCGTTGA CGATTCTGCT 
0061 TTGACTGCGG CGCTGCTGAA GCGTAACCAG GACCTGAGTC CCACTCCCAG CGAGCAGACG 
0121 GCTATTGGCA ATCTAGTGAC CAAGGTGCAG GCTGTTCTCG ACAATCTGGT GGTTGCACCC 
0181 GGGGATCTGA CAACTTGTCA ACTGGAGGAA GTGCGTCAGG TTGGCTCCTT CAAGAAGGGC 
0241 ACCATACTGA CGGGCAACAA TGTAGCCGAT GTGGTGGTTA TCCTCAAAAC CCTGCCCACC 
0301 AAGGAGGCCG TCGATGCGCT GGCCAAAAAA GTGGAGGCCG ACCTGAAGGC CAGCATGAAG 
0361 ACTGAAGTTC TGACCAAGGG CGATCAGCAC ACCGTACAGA TCCATGAGCG GGGCTTCGAC 
0421 ATCGCCAACG TGCATGCCAA GGTGCGCATT CTGATCGCCA CCTTGCCGCA GAATCTTCGC 
0481 AAGCTGGAGC CTGAGATCCA  
 Assemble Data

5641R-3.IR_full        1   CCCTCGCGGAGGTCTTCTTTCCCAAAGTTCCATCCGCCGGCGCCGTTGACGATTCTGCT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico      1   CCCTCGCGGAGGTCTTCTTTCCCAAAGTTCCATCCGCCGGCGCCGTTGACGATTCTGCT 59


5641R-3.IR_full       61  TTGACTGCGGCGCTGCTGAAGCGTAACCAGGACCTGAGTCCCACTCCCAGCGAGCAGACG 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     61  TTGACTGCGGCGCTGCTGAAGCGTAACCAGGACCTGAGTCCCACTCCCAGCGAGCAGACG 119


5641R-3.IR_full       121 GCTATTGGCAATCTAGTGACCAAGGTGCAGGCTGTTCTCGACAATCTGGTGGTTGCACCC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     121 GCTATTGGCAATCTAGTGACCAAGGTGCAGGCTGTTCTCGACAATCTGGTGGTTGCACCC 179


5641R-3.IR_full       181 GGGGATCTGACAACTTGTCAACTGGAGGAAGTGCGTCAGGTTGGCTCCTTCAAGAAGGGC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     181 GGGGATCTGACAACTTGTCAACTGGAGGAAGTGCGTCAGGTTGGCTCCTTCAAGAAGGGC 239


5641R-3.IR_full       241 ACCATACTGACGGGCAACAATGTAGCCGATGTGGTGGTTATCCTCAAAACCCTGCCCACC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     241 ACCATACTGACGGGCAACAATGTAGCCGATGTGGTGGTTATCCTCAAAACCCTGCCCACC 299


5641R-3.IR_full       301 AAGGAGGCCGTCGATGCGCTGGCCAAAAAAGTGGAGGCCGACCTGAAGGCCAGCATGAAG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     301 AAGGAGGCCGTCGATGCGCTGGCCAAAAAAGTGGAGGCCGACCTGAAGGCCAGCATGAAG 359


5641R-3.IR_full       361 ACTGAAGTTCTGACCAAGGGCGATCAGCACACCGTACAGATCCATGAGCGGGGCTTCGAC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     361 ACTGAAGTTCTGACCAAGGGCGATCAGCACACCGTACAGATCCATGAGCGGGGCTTCGAC 419


5641R-3.IR_full       421 ATCGCCAACGTGCATGCCAAGGTGCGCATTCTGATCGCCACCTTGCCGCAGAATCTTCGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5641R-3.in silico     421 ATCGCCAACGTGCATGCCAAGGTGCGCATTCTGATCGCCACCTTGCCGCAGAATCTTCGC 479


5641R-3.IR_full       481 AAGCTGGAGCCTGAGATCCA 499
                          ||||||||||||||||||||
5641R-3.in silico     481 AAGCTGGAGCCTGAGATCCA 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141939.2  CG5641-RA (CG5641), mRNA 
0   NM_079990.2  CG15667-RA, transcript variant A (Sara), mRNA 
0   NM_166451.1  CG15667-RB, transcript variant B (Sara), mRNA 
0   17  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001038952.1  CG33975-RA (CG33975), mRNA 
0   NM_135804.2  CG7099-RA (CG7099), mRNA 
0   10  NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_142598.1  CG17190-RA (CG17190), mRNA 
0   NM_167610.3  CG5659-RB, transcript variant B (ari-1), mRNA 
0   NM_078675.3  CG5659-RA, transcript variant A (ari-1), mRNA 
0   NM_206777.1  CG5659-RC, transcript variant C (ari-1), mRNA 
0   NM_167973.1  CG1271-RD, transcript variant D (CG1271), mRNA 
0   NM_206259.1  CG1271-RC, transcript variant C (CG1271), mRNA 
0   NM_139506.2  CG1271-RA, transcript variant A (CG1271), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_167974.1  CG1271-RB, transcript variant B (CG1271), mRNA 
0   13  52  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_137153.2  CG12855-RA (HPS), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_140866.1  CG9299-RA (CG9299), mRNA 
0   NM_164899.1  CG5686-RA (chico), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.