National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5632R-4 
 Symbol thoc6  Full Name thoc6 
 CG No CG5632  Old CG No CG5632 
 Synonyms THOC6, CG5632, thoc6 
 Accession No (Link to NCBI) NM_140300.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAACTGGACAAGGGTTCCGA 
 Primer Seq. 3'
aatctagaggtaccTGCCCCAATCCGGACGTAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAACTGGAC AAGGGTTCCG AGGAGCCACC TGGCAAACTG AAGATCTTCC CGCAGGGCAG 
0061 CGATGTGGAC ATCAATTACC TGGCCTTCCA TCGCGATTTC TTGATAGTTG GTGCAGTGGG 
0121 TCTTATTTAC GGATTGGAAT GGAACGAGGA GGAGGAATCT CTGGCCACCA AACGGTCCTG 
0181 GGAGGTAAAA ATACCCATGC AAGTGGATGC CGTCGAAGTG CCGGATGTGA ACTCCATGTG 
0241 GCTGGACTCG GAAAATAGCA TCCTGTTTGC TGGCTGTGGC NGACGGAGTG GATCTACCAA 
0301 GTGAGTTTGG AGGACGGACG AATTCAGCGC GAGTACCGCG GACACACAGA CTACGTGCAC 
0361 AGTGTGGTGG GCAATGCCAA CGGACAGATC TTCTCTGGCG CCGAGGATGG CACTGTGCGA 
0421 GTGTGGAGCA CCAAGCAGCA GCAGCACACT TCAATGCTGG AGCCTTACAA GAACCCAAAT 
0481 CTGTTACGTC CGGATTGGGG CA 
 in silico PCR Fragment
0001 AGAACTGGAC AAGGGTTCCG AGGAGCCACC TGGCAAACTG AAGATCTTCC CGCAGGGCAG 
0061 CGATGTGGAC ATCAATTACC TGGCCTTCCA TCGCGATTTC TTGATAGTTG GTGCAGTGGG 
0121 TCTTATTTAC GGATTGGAAT GGAACGAGGA GGAGGAATCT CTGGCCACCA AACGGTCCTG 
0181 GGAGGTAAAG ATACCCATGC AAGTGGATGC CGTCGAAGTG CCGGATGTGA ACTCCATGTG 
0241 GCTGGACTCG GAAAATAGCA TCCTGTTTGC TGGCTGTGGC -GACGGAGT- GATCTACCAA 
0301 GTGAGTTTGG AGGACGGACG AATTCAGCGC GAGTACCGCG GACACACAGA CTACGTGCAC 
0361 AGTGTGGTGG GCAATGCCAA CGGACAGATC TTCTCTGGCG CCGAGGATGG CACTGTGCGA 
0421 GTGTGGAGCA CCAAGCAGCA GCAGCACACT TCAATGCTGG AGCCTTACAA GAACCCAAAT 
0481 CTGTTACGTC CGGATTGGGG CA 
 Assemble Data

5632R-4.IR_full       1   AGAACTGGACAAGGGTTCCGAGGAGCCACCTGGCAAACTGAAGATCTTCCCGCAGGGCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     1   AGAACTGGACAAGGGTTCCGAGGAGCCACCTGGCAAACTGAAGATCTTCCCGCAGGGCAG 60


5632R-4.IR_full       61  CGATGTGGACATCAATTACCTGGCCTTCCATCGCGATTTCTTGATAGTTGGTGCAGTGGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     61  CGATGTGGACATCAATTACCTGGCCTTCCATCGCGATTTCTTGATAGTTGGTGCAGTGGG 120


5632R-4.IR_full       121 TCTTATTTACGGATTGGAATGGAACGAGGAGGAGGAATCTCTGGCCACCAAACGGTCCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     121 TCTTATTTACGGATTGGAATGGAACGAGGAGGAGGAATCTCTGGCCACCAAACGGTCCTG 180


5632R-4.IR_full       181 GGAGGTAAAAATACCCATGCAAGTGGATGCCGTCGAAGTGCCGGATGTGAACTCCATGTG 240
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     181 GGAGGTAAAGATACCCATGCAAGTGGATGCCGTCGAAGTGCCGGATGTGAACTCCATGTG 240


5632R-4.IR_full       241 GCTGGACTCGGAAAATAGCATCCTGTTTGCTGGCTGTGGCNGACGGAGTGGATCTACCAA 300
                          |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||
5632R-4.in silico     241 GCTGGACTCGGAAAATAGCATCCTGTTTGCTGGCTGTGGC-GACGGAGT-GATCTACCAA 300


5632R-4.IR_full       301 GTGAGTTTGGAGGACGGACGAATTCAGCGCGAGTACCGCGGACACACAGACTACGTGCAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     301 GTGAGTTTGGAGGACGGACGAATTCAGCGCGAGTACCGCGGACACACAGACTACGTGCAC 360


5632R-4.IR_full       361 AGTGTGGTGGGCAATGCCAACGGACAGATCTTCTCTGGCGCCGAGGATGGCACTGTGCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     361 AGTGTGGTGGGCAATGCCAACGGACAGATCTTCTCTGGCGCCGAGGATGGCACTGTGCGA 420


5632R-4.IR_full       421 GTGTGGAGCACCAAGCAGCAGCAGCACACTTCAATGCTGGAGCCTTACAAGAACCCAAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5632R-4.in silico     421 GTGTGGAGCACCAAGCAGCAGCAGCACACTTCAATGCTGGAGCCTTACAAGAACCCAAAT 480


5632R-4.IR_full       481 CTGTTACGTCCGGATTGGGGCA 502
                          ||||||||||||||||||||||
5632R-4.in silico     481 CTGTTACGTCCGGATTGGGGCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140300.2  CG5632-RA (thoc6), mRNA 
0   NM_135084.1  CG14020-RA (CG14020), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_137120.1  CG17386-RA (CG17386), mRNA 
0   NM_137921.1  CG30188-RA (CG30188), mRNA 
0   NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0   NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_057932.1  CG7287-RA (Lcp65Aa), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_166291.1  CG30116-RD, transcript variant D (CG30116), mRNA 
0   NM_137494.1  CG30116-RB, transcript variant B (CG30116), mRNA 
0   NM_137493.2  CG30116-RC, transcript variant C (CG30116), mRNA 
0   NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_169770.2  CG18212-RE, transcript variant E (CG18212), mRNA 
0   NM_169771.1  CG18212-RF, transcript variant F (CG18212), mRNA 
0   NM_169769.1  CG18212-RD, transcript variant D (CG18212), mRNA 
0   NM_206505.1  CG18212-RB, transcript variant B (CG18212), mRNA 
0   NM_169768.1  CG18212-RA, transcript variant A (CG18212), mRNA 
0   NM_142388.2  CG18212-RG, transcript variant G (CG18212), mRNA 
0   10  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.