National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5632R-2 
 Symbol thoc6  Full Name thoc6 
 CG No CG5632  Old CG No CG5632 
 Synonyms THOC6, CG5632, thoc6 
 Accession No (Link to NCBI) NM_140300.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGAACTGGACAAGGGTTCCGAGGAGCCACCTGGCAAACTGAAGATCTTCCCGCAGGGCAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGATGTGGACATCAATTACCTGGCCTTCCATCGCGATTTCTTGATAGTTGGTGCAGTGGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTTATTTACGGATTGGAATGGAACGAGGAGGAGGAATCTCTGGCCACCAAACGGTCCTG 180

                          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGAGGTAAAGATACCCATGCAAGTGGATGCCGTCGAAGTGCCGGATGTGAACTCCATGTG 240

                          |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| silico     241 GCTGGACTCGGAAAATAGCATCCTGTTTGCTGGCTGTGGC-GACGGAGT-GATCTACCAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTGAGTTTGGAGGACGGACGAATTCAGCGCGAGTACCGCGGACACACAGACTACGTGCAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGTGTGGTGGGCAATGCCAACGGACAGATCTTCTCTGGCGCCGAGGATGGCACTGTGCGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTGTGGAGCACCAAGCAGCAGCAGCACACTTCAATGCTGGAGCCTTACAAGAACCCAAAT 480

5632R-2.IR_full       481 CTGTTACGTCCGGATTGGGGCA 502
                          |||||||||||||||||||||| silico     481 CTGTTACGTCCGGATTGGGGCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140300.2  CG5632-RA (thoc6), mRNA 
0   NM_135084.1  CG14020-RA (CG14020), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_137120.1  CG17386-RA (CG17386), mRNA 
0   NM_137921.1  CG30188-RA (CG30188), mRNA 
0   NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0   NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_057932.1  CG7287-RA (Lcp65Aa), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_166291.1  CG30116-RD, transcript variant D (CG30116), mRNA 
0   NM_137494.1  CG30116-RB, transcript variant B (CG30116), mRNA 
0   NM_137493.2  CG30116-RC, transcript variant C (CG30116), mRNA 
0   NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_169770.2  CG18212-RE, transcript variant E (CG18212), mRNA 
0   NM_169771.1  CG18212-RF, transcript variant F (CG18212), mRNA 
0   NM_169769.1  CG18212-RD, transcript variant D (CG18212), mRNA 
0   NM_206505.1  CG18212-RB, transcript variant B (CG18212), mRNA 
0   NM_169768.1  CG18212-RA, transcript variant A (CG18212), mRNA 
0   NM_142388.2  CG18212-RG, transcript variant G (CG18212), mRNA 
0   10  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.