National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5626R-3 
 Symbol CG5626  Full Name CG5626 
 CG No CG5626  Old CG No CG5626 
 Synonyms CG5626 
 Accession No (Link to NCBI) NM_140302.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGCGCATCGTCACACTGAAT 
 Primer Seq. 3'
aatctagaggtaccCTTCAGCAGTGCCCAAATACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGCGCATCG TCACACTGAA TTCGAACCTC CGAGTGGAGG TCTAAAGCGT ACTAAAAATG 
0061 AGGGAACTGC AGCGGAAGTT GAGGATCTTA AACGAGCGCA GGAGTATTTG CGTGCTCAAT 
0121 TGTCAGTGCC TCGAATAGAA AGACTCGGAG GAAGGGCACT TGCCATTTGG AACGATGAGC 
0181 AACAAGTGGC AGAAGTCAAA CGCAAAGATG GGAAATTCGA AAATTTCGGA TACAGTGAGC 
0241 AGGGAAAGCT CTATTTGGAG TACTATGAAG CTATGTTCCT ACTAGAAGTT GGACGTTTAC 
0301 AACTGGAGTA CTGTGGTTTA GTAGTTTCAA TTGAGCAAGC TTATGTGCTC CTCCTCGGCG 
0361 AGTTGGAAAG CGAAAGGTAC ACCAACTACC TAGTTTACTC GGCTTTATCC CGATCTGGCT 
0421 ATATAGTAGT GAAACATGTG CCTCCTCAGG AAATTCAACA TGAAGTTACG AGTGCAGATT 
0481 GTATTTGGGC ACTGCTGAAG  
 in silico PCR Fragment
0001 TTGCGCATCG TCACACTGAA TTCGAACCTC CGAGTGGAGG TCTAAAGCGT ACTAAAAATG 
0061 AGGGAACTGC AGCGGAAGTT GAGGAGCTTA AACGAGCGCA GGAGTATTTG CGTGCTCAAT 
0121 TGTCAGTGCC TCGAATAGAA AGACTCGGAG GAAGGGCACT TGCCATTTGG AACGAAGAGC 
0181 AACAAGTGGC AGAAGTCAAA CGCAAAGATG GTAAATTTGA AAATTTCGGA TACAGTGAGC 
0241 AGGGAAAGCT CTATTTGGAG TACTATGAAG CTATGTTCCT ACTAGAAGTT GGACGTTTAC 
0301 AACTGGAGTA CTGTGGTTTA GTAGTTTCAA TTGAGCAAGC ATATGTGCTC CTCCTCGGCG 
0361 AGTTGGAAAG CGAAAGGTAC ACCAACTACC TAGTTTACTC GGCTTTATCC CGATCTGGCT 
0421 ATATAGTAGT GAAACATGTG CCTCCTAAGG AAATTCCACA AGAAGTTACG AGTGCAGATT 
0481 GTATTTGGGC ACTGCTGAAG  
 Assemble Data

5626R-3.IR_full       1   TTGCGCATCGTCACACTGAATTCGAACCTCCGAGTGGAGGTCTAAAGCGTACTAAAAATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5626R-3.in silico     1   TTGCGCATCGTCACACTGAATTCGAACCTCCGAGTGGAGGTCTAAAGCGTACTAAAAATG 60


5626R-3.IR_full       61  AGGGAACTGCAGCGGAAGTTGAGGATCTTAAACGAGCGCAGGAGTATTTGCGTGCTCAAT 120
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
5626R-3.in silico     61  AGGGAACTGCAGCGGAAGTTGAGGAGCTTAAACGAGCGCAGGAGTATTTGCGTGCTCAAT 120


5626R-3.IR_full       121 TGTCAGTGCCTCGAATAGAAAGACTCGGAGGAAGGGCACTTGCCATTTGGAACGATGAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
5626R-3.in silico     121 TGTCAGTGCCTCGAATAGAAAGACTCGGAGGAAGGGCACTTGCCATTTGGAACGAAGAGC 180


5626R-3.IR_full       181 AACAAGTGGCAGAAGTCAAACGCAAAGATGGGAAATTCGAAAATTTCGGATACAGTGAGC 240
                          ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
5626R-3.in silico     181 AACAAGTGGCAGAAGTCAAACGCAAAGATGGTAAATTTGAAAATTTCGGATACAGTGAGC 240


5626R-3.IR_full       241 AGGGAAAGCTCTATTTGGAGTACTATGAAGCTATGTTCCTACTAGAAGTTGGACGTTTAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5626R-3.in silico     241 AGGGAAAGCTCTATTTGGAGTACTATGAAGCTATGTTCCTACTAGAAGTTGGACGTTTAC 300


5626R-3.IR_full       301 AACTGGAGTACTGTGGTTTAGTAGTTTCAATTGAGCAAGCTTATGTGCTCCTCCTCGGCG 360
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
5626R-3.in silico     301 AACTGGAGTACTGTGGTTTAGTAGTTTCAATTGAGCAAGCATATGTGCTCCTCCTCGGCG 360


5626R-3.IR_full       361 AGTTGGAAAGCGAAAGGTACACCAACTACCTAGTTTACTCGGCTTTATCCCGATCTGGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5626R-3.in silico     361 AGTTGGAAAGCGAAAGGTACACCAACTACCTAGTTTACTCGGCTTTATCCCGATCTGGCT 420


5626R-3.IR_full       421 ATATAGTAGTGAAACATGTGCCTCCTCAGGAAATTCAACATGAAGTTACGAGTGCAGATT 480
                          |||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||
5626R-3.in silico     421 ATATAGTAGTGAAACATGTGCCTCCTAAGGAAATTCCACAAGAAGTTACGAGTGCAGATT 480


5626R-3.IR_full       481 GTATTTGGGCACTGCTGAAG 500
                          ||||||||||||||||||||
5626R-3.in silico     481 GTATTTGGGCACTGCTGAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140302.1  CG5626-RA (CG5626), mRNA 
0   NM_079237.1  CG4321-RA (Cyp4d8), mRNA 
0   NM_001043253.1  CG14885-RC, transcript variant C (Gyc-89Da), mRNA 
0   NM_137084.2  CG8241-RA (CG8241), mRNA 
0   NM_135607.2  CG6495-RA (CG6495), mRNA 
0   NM_139983.2  CG32355-RA (CG32355), mRNA 
0   NM_142146.1  CG14860-RA (CG14860), mRNA 
0   NM_165201.1  CG31805-RA (CG31805), mRNA 
0   NM_132569.1  CG11245-RA (CG11245), mRNA 
0   NM_057471.4  CG4260-RA, transcript variant A (alpha-Adaptin), mRNA 
0   NM_205885.1  CG4260-RB, transcript variant B (alpha-Adaptin), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_141393.2  CG1041-RA, transcript variant A (CG1041), mRNA 
0   NM_001043219.1  CG1041-RB, transcript variant B (CG1041), mRNA 
0   NM_140497.2  CG6869-RA (FucTA), mRNA 
0   NM_078924.3  CG12165-RA (Incenp), mRNA 
0   NM_140007.1  CG5747-RA (mfr), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_080064.2  CG32505-RA, transcript variant A (Pp4-19C), mRNA 
0   NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_167703.3  CG32505-RE, transcript variant E (Pp4-19C), mRNA 
0   NM_168506.1  CG32112-RA, transcript variant A (CG32112), mRNA 
0   NM_168507.1  CG32112-RB, transcript variant B (CG32112), mRNA 
0   NM_134872.1  CG3123-RA (CG3123), mRNA 
0   NM_136951.2  CG8569-RA (CG8569), mRNA 
0   NM_165580.2  CG8726-RA, transcript variant A (CG8726), mRNA 
0   NM_136497.3  CG8726-RB, transcript variant B (CG8726), mRNA 
0   NM_166910.1  CG14815-RA, transcript variant A (CG14815), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.