National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5610R-1 
 Symbol nAcRalpha-96Aa  Full Name nicotinic Acetylcholine Receptor alpha 96Aa 
 CG No CG5610  Old CG No CG5610 
 Synonyms nAChR, ALS, nAcr96Aa, nAcRs, Acr96Aa, als, alpha1, alpha-like, ALs, CG5610, AcrB, Acr96A, nAcRalpha-96Aa, dALS 
 Accession No (Link to NCBI) NM_079757.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCCAGCTGATCGATGTGAA 
 Primer Seq. 3'
aatctagaggtaccCCTCGCAGCAGCTGTAGAACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCCCAGCTG ATCGATGTGA ATCTAAAGAA TCAAATTATG ACAACCAATG TCTGGGTGGA 
0061 ACAGGAATGG AACGACTATA AATTGAAATG GAATCCGGAT GACTATGGCG GCGTGGACAC 
0121 TTTGCACGTT CCCTCCGAGC ATATATGGCT ACCGGATATT GTGCTCTATA ACAACGCCGA 
0181 TGGCAACTAT GAAGTGACAA TAATGACAAA AGCAATTCTT CATCACACGG GCAAAGTGGT 
0241 GTGGAAACCG CCCGCCATTT ACAAATCCTT CTGCGAAATT GATGTCGAGT ACTTTCCCTT 
0301 CGACGAGCAG ACATGTTTCA TGAAGTTCGG ATCCTGGACC TACGATGGTT ACATGGTGGA 
0361 CTTGAGGCAC TTGAAGCAGA CCGCCGATTC GGACAACATC GAGGTGGGCA TCGACCTGCA 
0421 GGACTACTAC ATCTCCGTGG AGTGGGACAT CATGCGTGTG CCGGCGGTGC GGNAACGAGA 
0481 AGTTCTACAG CTGCTGCGAG G 
 in silico PCR Fragment
0001 CTCCCAGCTG ATCGATGTGA ATCTAAAGAA TCAAATTATG ACAACCAATG TCTGGGTGGA 
0061 ACAGGAATGG AACGACTATA AATTGAAATG GAATCCGGAT GACTATGGCG GCGTGGACAC 
0121 TTTGCACGTT CCCTCCGAGC ATATATGGCT ACCGGATATT GTGCTCTATA ACAACGCCGA 
0181 TGGCAACTAT GAAGTGACAA TAATGACAAA AGCAATTCTT CATCACACGG GCAAAGTGGT 
0241 GTGGAAACCG CCCGCCATTT ACAAATCCTT CTGCGAAATT GATGTCGAGT ACTTTCCCTT 
0301 CGACGAGCAG ACATGTTTCA TGAAGTTCGG ATCCTGGACC TACGATGGTT ACATGGTGGA 
0361 CTTGAGGCAC TTGAAGCAGA CCGCCGACTC GGACAACATC GAGGTGGGCA TCGACCTGCA 
0421 GGACTACTAC ATCTCCGTGG AGTGGGACAT CATGCGTGTG CCGGCGGTGC GG-AACGAGA 
0481 AGTTCTACAG CTGCTGCGAG G 
 Assemble Data

5610R-1.IR_full       1   CTCCCAGCTGATCGATGTGAATCTAAAGAATCAAATTATGACAACCAATGTCTGGGTGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5610R-1.in silico     1   CTCCCAGCTGATCGATGTGAATCTAAAGAATCAAATTATGACAACCAATGTCTGGGTGGA 60


5610R-1.IR_full       61  ACAGGAATGGAACGACTATAAATTGAAATGGAATCCGGATGACTATGGCGGCGTGGACAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5610R-1.in silico     61  ACAGGAATGGAACGACTATAAATTGAAATGGAATCCGGATGACTATGGCGGCGTGGACAC 120


5610R-1.IR_full       121 TTTGCACGTTCCCTCCGAGCATATATGGCTACCGGATATTGTGCTCTATAACAACGCCGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5610R-1.in silico     121 TTTGCACGTTCCCTCCGAGCATATATGGCTACCGGATATTGTGCTCTATAACAACGCCGA 180


5610R-1.IR_full       181 TGGCAACTATGAAGTGACAATAATGACAAAAGCAATTCTTCATCACACGGGCAAAGTGGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5610R-1.in silico     181 TGGCAACTATGAAGTGACAATAATGACAAAAGCAATTCTTCATCACACGGGCAAAGTGGT 240


5610R-1.IR_full       241 GTGGAAACCGCCCGCCATTTACAAATCCTTCTGCGAAATTGATGTCGAGTACTTTCCCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5610R-1.in silico     241 GTGGAAACCGCCCGCCATTTACAAATCCTTCTGCGAAATTGATGTCGAGTACTTTCCCTT 300


5610R-1.IR_full       301 CGACGAGCAGACATGTTTCATGAAGTTCGGATCCTGGACCTACGATGGTTACATGGTGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5610R-1.in silico     301 CGACGAGCAGACATGTTTCATGAAGTTCGGATCCTGGACCTACGATGGTTACATGGTGGA 360


5610R-1.IR_full       361 CTTGAGGCACTTGAAGCAGACCGCCGATTCGGACAACATCGAGGTGGGCATCGACCTGCA 420
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
5610R-1.in silico     361 CTTGAGGCACTTGAAGCAGACCGCCGACTCGGACAACATCGAGGTGGGCATCGACCTGCA 420


5610R-1.IR_full       421 GGACTACTACATCTCCGTGGAGTGGGACATCATGCGTGTGCCGGCGGTGCGGNAACGAGA 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
5610R-1.in silico     421 GGACTACTACATCTCCGTGGAGTGGGACATCATGCGTGTGCCGGCGGTGCGG-AACGAGA 480


5610R-1.IR_full       481 AGTTCTACAGCTGCTGCGAGG 501
                          |||||||||||||||||||||
5610R-1.in silico     481 AGTTCTACAGCTGCTGCGAGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.