National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5608R-3 
 Symbol CG5608  Full Name CG5608 
 CG No CG5608  Old CG No CG5608 
 Synonyms CG5608 
 Accession No (Link to NCBI) NM_141951.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGGCGA-CAAGGTGTACGAGAAACGTAAGCTGGCCTCGCAGGAGATCGAGAAAATGGTCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGGAATTCAACAACAAAAACAACTCGGCCCAGATCCGCAAGCTGATCGAGGTTCTGGCCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGATTATGCCACATCACGGGACGCAAACCGAAGAAAAGGAGCGCTTATCGGTCTGGCAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCATGGGTTTAGGGCTGGGCAAGGATTCCGGCAAGTATGTCCAGGGCATGGTGACGCCCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCATGACCTGCCTGTCGGATCCGGATATCCGTGTGCGGTACTTCGCCTGCGAGTCCCTGT 300

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACAACGTGGTGAA-GGTGGCCCGCTCTGCGATCATTCCCTTCTTCCCGGAGCTTTTTGCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCACTATCGCGTCTCGTCACTGATTCAGATCAAATGGTGAAGGACGGCAGCGAATTGCTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GATCGCCTTCTAAAGGACATTGTCACGGAATCGTCGCAAACATTCAATCTGCAGGCGTTC 480

5608R-3.IR_full       481 ATTCCTTTGCTGAGGGAGCACA 502
                          |||||||||||||||||||||| silico     481 ATTCCTTTGCTGAGGGAGCACA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141951.1  CG5608-RA (CG5608), mRNA 
0.41   NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0.41   NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
0.41   NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
0   NM_206123.1  CG33464-RA (CG33464), mRNA 
0   NM_169459.1  CG11502-RC, transcript variant C (svp), mRNA 
0   NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   NM_079601.2  CG11502-RB, transcript variant B (svp), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_136994.2  CG13326-RA (CG13326), mRNA 
0   15  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_205941.1  CG3748-RA, transcript variant A (CG3748), mRNA 
0   NM_135437.3  CG3748-RB, transcript variant B (CG3748), mRNA 
0   NM_170656.1  CG10772-RD, transcript variant D (Fur1), mRNA 
0   NM_206570.1  CG10772-RF, transcript variant F (Fur1), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_170655.1  CG10772-RC, transcript variant C (Fur1), mRNA 
0   NM_206571.1  CG10772-RE, transcript variant E (Fur1), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_079396.2  CG9712-RA (TSG101), mRNA 
0   NM_142795.1  CG5377-RA (CG5377), mRNA 
0   NM_168655.1  CG32155-RA (CG32155), mRNA 
0   NM_001032224.1  CG1865-RB, transcript variant B (Spn43Ab), mRNA 
0   NM_080065.3  CG1865-RA, transcript variant A (Spn43Ab), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.