National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5608R-1 
 Symbol CG5608  Full Name CG5608 
 CG No CG5608  Old CG No CG5608 
 Synonyms CG5608 
 Accession No (Link to NCBI) NM_141951.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGCGACAAGGTGTACGAGAA 
 Primer Seq. 3'
aatctagaggtaccTGTGCTCCCTCAGCAAAGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGCGANCAA GGTGTACGAG AAACGTAAGC TGGCCTCGCA GGAGATCGAG AAAATGGTCA 
0061 CGGAATTCAA CAACAAAAAC AACTCGGCCC AGATCCGCAA GCTGATCGAG GTTCTGGCCA 
0121 CGGATTATGC CACATCACGG GACGCAAACC GAAGAAAAGG AGCGCTTATC GGTCTGGCAG 
0181 CCATGGGTTT AGGGCTGGGC AAGGATTCCG GCAAGTATGT CCAGGGCATG GTGACGCCCA 
0241 TCATGACCTG CCTGTCGGAT CCGGATATCC GTGTGCGGTA CTTCGCCTGC GAGTCCCTGT 
0301 ACAACGTGGT GAANGGTGGC CCGCTCTGCG ATCATTCCCT TCTTCCCGGA GCTTTTTGCA 
0361 GCACTATCGC GTCTCGTCAC TGATTCAGAT CAAATGGTGA AGGACGGCAG CGAATTGCTG 
0421 GATCGCCTTC TAAAGGACAT TGTCACGGAA TCGTCGCAAA CATTCAATCT GCAGGCGTTC 
0481 ATTCCTTTGC TGAGGGAGCA CA 
 in silico PCR Fragment
0001 GGGCGA-CAA GGTGTACGAG AAACGTAAGC TGGCCTCGCA GGAGATCGAG AAAATGGTCA 
0061 CGGAATTCAA CAACAAAAAC AACTCGGCCC AGATCCGCAA GCTGATCGAG GTTCTGGCCA 
0121 CGGATTATGC CACATCACGG GACGCAAACC GAAGAAAAGG AGCGCTTATC GGTCTGGCAG 
0181 CCATGGGTTT AGGGCTGGGC AAGGATTCCG GCAAGTATGT CCAGGGCATG GTGACGCCCA 
0241 TCATGACCTG CCTGTCGGAT CCGGATATCC GTGTGCGGTA CTTCGCCTGC GAGTCCCTGT 
0301 ACAACGTGGT GAA-GGTGGC CCGCTCTGCG ATCATTCCCT TCTTCCCGGA GCTTTTTGCA 
0361 GCACTATCGC GTCTCGTCAC TGATTCAGAT CAAATGGTGA AGGACGGCAG CGAATTGCTG 
0421 GATCGCCTTC TAAAGGACAT TGTCACGGAA TCGTCGCAAA CATTCAATCT GCAGGCGTTC 
0481 ATTCCTTTGC TGAGGGAGCA CA 
 Assemble Data

5608R-1.IR_full       1   GGGCGANCAAGGTGTACGAGAAACGTAAGCTGGCCTCGCAGGAGATCGAGAAAATGGTCA 60
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     1   GGGCGA-CAAGGTGTACGAGAAACGTAAGCTGGCCTCGCAGGAGATCGAGAAAATGGTCA 60


5608R-1.IR_full       61  CGGAATTCAACAACAAAAACAACTCGGCCCAGATCCGCAAGCTGATCGAGGTTCTGGCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     61  CGGAATTCAACAACAAAAACAACTCGGCCCAGATCCGCAAGCTGATCGAGGTTCTGGCCA 120


5608R-1.IR_full       121 CGGATTATGCCACATCACGGGACGCAAACCGAAGAAAAGGAGCGCTTATCGGTCTGGCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     121 CGGATTATGCCACATCACGGGACGCAAACCGAAGAAAAGGAGCGCTTATCGGTCTGGCAG 180


5608R-1.IR_full       181 CCATGGGTTTAGGGCTGGGCAAGGATTCCGGCAAGTATGTCCAGGGCATGGTGACGCCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     181 CCATGGGTTTAGGGCTGGGCAAGGATTCCGGCAAGTATGTCCAGGGCATGGTGACGCCCA 240


5608R-1.IR_full       241 TCATGACCTGCCTGTCGGATCCGGATATCCGTGTGCGGTACTTCGCCTGCGAGTCCCTGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     241 TCATGACCTGCCTGTCGGATCCGGATATCCGTGTGCGGTACTTCGCCTGCGAGTCCCTGT 300


5608R-1.IR_full       301 ACAACGTGGTGAANGGTGGCCCGCTCTGCGATCATTCCCTTCTTCCCGGAGCTTTTTGCA 360
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     301 ACAACGTGGTGAA-GGTGGCCCGCTCTGCGATCATTCCCTTCTTCCCGGAGCTTTTTGCA 360


5608R-1.IR_full       361 GCACTATCGCGTCTCGTCACTGATTCAGATCAAATGGTGAAGGACGGCAGCGAATTGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     361 GCACTATCGCGTCTCGTCACTGATTCAGATCAAATGGTGAAGGACGGCAGCGAATTGCTG 420


5608R-1.IR_full       421 GATCGCCTTCTAAAGGACATTGTCACGGAATCGTCGCAAACATTCAATCTGCAGGCGTTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5608R-1.in silico     421 GATCGCCTTCTAAAGGACATTGTCACGGAATCGTCGCAAACATTCAATCTGCAGGCGTTC 480


5608R-1.IR_full       481 ATTCCTTTGCTGAGGGAGCACA 502
                          ||||||||||||||||||||||
5608R-1.in silico     481 ATTCCTTTGCTGAGGGAGCACA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141951.1  CG5608-RA (CG5608), mRNA 
0.41   NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0.41   NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
0.41   NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
0   NM_206123.1  CG33464-RA (CG33464), mRNA 
0   NM_169459.1  CG11502-RC, transcript variant C (svp), mRNA 
0   NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   NM_079601.2  CG11502-RB, transcript variant B (svp), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_136994.2  CG13326-RA (CG13326), mRNA 
0   15  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_205941.1  CG3748-RA, transcript variant A (CG3748), mRNA 
0   NM_135437.3  CG3748-RB, transcript variant B (CG3748), mRNA 
0   NM_170656.1  CG10772-RD, transcript variant D (Fur1), mRNA 
0   NM_206570.1  CG10772-RF, transcript variant F (Fur1), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_170655.1  CG10772-RC, transcript variant C (Fur1), mRNA 
0   NM_206571.1  CG10772-RE, transcript variant E (Fur1), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_079396.2  CG9712-RA (TSG101), mRNA 
0   NM_142795.1  CG5377-RA (CG5377), mRNA 
0   NM_168655.1  CG32155-RA (CG32155), mRNA 
0   NM_001032224.1  CG1865-RB, transcript variant B (Spn43Ab), mRNA 
0   NM_080065.3  CG1865-RA, transcript variant A (Spn43Ab), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.