National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5589R-2 
 Symbol CG5589  Full Name CG5589 
 CG No CG5589  Old CG No CG5589 
 Synonyms DmRH17, cg5589, CG5589 
 Accession No (Link to NCBI) NM_140752.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCACTGCCGGAGGTTTCTAA 
 Primer Seq. 3'
aatctagaggtaccGAGTGGGAGCAAGGACCAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCACTGCCG GAGGTTTCTA AACATTGAGG AGCCGGTGAA AAGTGAAGAG TCAGATAAAG 
0061 ATGATGAAGA TATCACAGAG TTCCGTCTCT TGGACGGGGA TTCCAGCAAT CAACCGAAAC 
0121 GCAAGAAGCC GAAGAAAGAG AAGACACTAT CCCCAAAGGA ATTAGAGATT CAAAAGGCAG 
0181 CCGAAGAGGC AAACGAGACG CGGAAGCAGT ATGGCATTAG GGTGCTGGGC AAGAATGTTC 
0241 CTCCACCGGT GGACAGTTTC GGAACATTGA CCAGGGACTT TAAGATGCTG CCTCGCCTGC 
0301 AGCAGAACCT ACTGTCTCGC AACTTCGACC GCCCCACGCC GATCCAGATG CAGGCCCTGC 
0361 CCGTACTCCT CCAGCGACGG GCGCTAATGG CCTGTGCACC CACTGGATCC GGCAAAACGC 
0421 TGGCCTTCCT CACACCCATC ATAAACGGCC TGAGGGCGCA CAAGACAACT GGACTGAGAG 
0481 CTCTGGTCCT TGCTCCCACT C 
 in silico PCR Fragment
0001 GCCACTGCCG GAGGTTTCTA AACA-TGAGG AGCCGGTGAA AAGCGAAGAG TCAGATAAAG 
0061 ATGATGAAGA TATCACAGAG TTCCGTCTCT TGGACGGGGA TTCCAGCAAT CAACCGAAAC 
0121 GCAAGAAGCC GAAGAAAGAG AAGACACTAT CCCCCAAGGA ATTAGAGATT CAAAAGGCAG 
0181 CCGAAGAGGC AAACGAGACG CGGAAGCAGT ATGGCATTAG GGTGTTGGGC AAGAATGTTC 
0241 CTCCACCGGT GGACAGTTTC GGAACATTGA CCAGGGACTT TAAGATGCTG CCTCGCCTGC 
0301 AGCAGAACCT ACTGTCTCGC AACTTTGACC ACCCCACGCC GATCCAGATG CAGGCCCTGC 
0361 CCGTACTCCT CCAGCGACGG GCGCTAATGG CCTGTGCACC CACTGGATCC GGCAAAACGC 
0421 TGGCCTTCCT CACACCCATC ATAAATGGCC TGAGGGCGCA CAAGACAACT GGACTGAGAG 
0481 CTCTGGTCCT TGCTCCCACT C 
 Assemble Data

5589R-2.IR_full       1   GCCACTGCCGGAGGTTTCTAAACATTGAGGAGCCGGTGAAAAGTGAAGAGTCAGATAAAG 60
                          |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||
5589R-2.in silico     1   GCCACTGCCGGAGGTTTCTAAACA-TGAGGAGCCGGTGAAAAGCGAAGAGTCAGATAAAG 60


5589R-2.IR_full       61  ATGATGAAGATATCACAGAGTTCCGTCTCTTGGACGGGGATTCCAGCAATCAACCGAAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5589R-2.in silico     61  ATGATGAAGATATCACAGAGTTCCGTCTCTTGGACGGGGATTCCAGCAATCAACCGAAAC 120


5589R-2.IR_full       121 GCAAGAAGCCGAAGAAAGAGAAGACACTATCCCCAAAGGAATTAGAGATTCAAAAGGCAG 180
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
5589R-2.in silico     121 GCAAGAAGCCGAAGAAAGAGAAGACACTATCCCCCAAGGAATTAGAGATTCAAAAGGCAG 180


5589R-2.IR_full       181 CCGAAGAGGCAAACGAGACGCGGAAGCAGTATGGCATTAGGGTGCTGGGCAAGAATGTTC 240
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
5589R-2.in silico     181 CCGAAGAGGCAAACGAGACGCGGAAGCAGTATGGCATTAGGGTGTTGGGCAAGAATGTTC 240


5589R-2.IR_full       241 CTCCACCGGTGGACAGTTTCGGAACATTGACCAGGGACTTTAAGATGCTGCCTCGCCTGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5589R-2.in silico     241 CTCCACCGGTGGACAGTTTCGGAACATTGACCAGGGACTTTAAGATGCTGCCTCGCCTGC 300


5589R-2.IR_full       301 AGCAGAACCTACTGTCTCGCAACTTCGACCGCCCCACGCCGATCCAGATGCAGGCCCTGC 360
                          ||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||
5589R-2.in silico     301 AGCAGAACCTACTGTCTCGCAACTTTGACCACCCCACGCCGATCCAGATGCAGGCCCTGC 360


5589R-2.IR_full       361 CCGTACTCCTCCAGCGACGGGCGCTAATGGCCTGTGCACCCACTGGATCCGGCAAAACGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5589R-2.in silico     361 CCGTACTCCTCCAGCGACGGGCGCTAATGGCCTGTGCACCCACTGGATCCGGCAAAACGC 420


5589R-2.IR_full       421 TGGCCTTCCTCACACCCATCATAAACGGCCTGAGGGCGCACAAGACAACTGGACTGAGAG 480
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
5589R-2.in silico     421 TGGCCTTCCTCACACCCATCATAAATGGCCTGAGGGCGCACAAGACAACTGGACTGAGAG 480


5589R-2.IR_full       481 CTCTGGTCCTTGCTCCCACTC 501
                          |||||||||||||||||||||
5589R-2.in silico     481 CTCTGGTCCTTGCTCCCACTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140752.1  CG5589-RA (CG5589), mRNA 
0.2   NM_143183.1  CG5948-RA (CG5948), mRNA 
0   11  NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   11  NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   12  21  NM_141758.3  CG6544-RA, transcript variant A (fau), mRNA 
0   NM_137299.1  CG5065-RA (CG5065), mRNA 
0   NM_134506.1  CG12531-RA (CG12531), mRNA 
0   NM_134860.2  CG9961-RA (CG9961), mRNA 
0   NM_132141.1  CG14431-RA (CG14431), mRNA 
0   NM_137068.2  CG13345-RA (RacGAP50C), mRNA 
0   NM_130601.2  CG32803-RA, transcript variant A (CG32803), mRNA 
0   NM_080144.1  CG15844-RA (Klp54D), mRNA 
0   NM_080162.3  CG9900-RB, transcript variant B (mit(1)15), mRNA 
0   NM_001038739.1  CG9900-RC, transcript variant C (mit(1)15), mRNA 
0   NM_168477.1  CG32092-RB (CG32092), mRNA 
0   NM_141964.2  CG6225-RA (CG6225), mRNA 
0   NM_164750.1  CG5973-RA, transcript variant A (CG5973), mRNA 
0   NM_142742.2  CG6332-RA (CG6332), mRNA 
0   NM_142277.1  CG10309-RA (pad), mRNA 
0   NM_136251.2  CG9246-RA (CG9246), mRNA 
0   10  NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_142461.2  CG14309-RA (CG14309), mRNA 
0   NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_141691.1  CG8500-RA (CG8500), mRNA 
0   NM_169095.1  CG1093-RB, transcript variant B (plx), mRNA 
0   NM_169094.1  CG1093-RA, transcript variant A (plx), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_137082.1  CG13353-RA (CG13353), mRNA 
0   NM_058091.3  CG3152-RA (Trap1), mRNA 
0   NM_134676.1  CG4213-RA (CG4213), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.