National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5589R-1 
 Symbol CG5589  Full Name CG5589 
 CG No CG5589  Old CG No CG5589 
 Synonyms DmRH17, cg5589, CG5589 
 Accession No (Link to NCBI) NM_140752.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| silico     1   GCCACTGCCGGAGGTTTCTAAACA-TGAGGAGCCGGTGAAAAGCGAAGAGTCAGATAAAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGATGAAGATATCACAGAGTTCCGTCTCTTGGACGGGGATTCCAGCAATCAACCGAAAC 120

                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     121 GCAAGAAGCCGAAGAAAGAGAAGACACTATCCCCCAAGGAATTAGAGATTCAAAAGGCAG 180

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     181 CCGAAGAGGCAAACGAGACGCGGAAGCAGTATGGCATTAGGGTGTTGGGCAAGAATGTTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTCCACCGGTGGACAGTTTCGGAACATTGACCAGGGACTTTAAGATGCTGCCTCGCCTGC 300

                          ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| silico     301 AGCAGAACCTACTGTCTCGCAACTTTGACCACCCCACGCCGATCCAGATGCAGGCCCTGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGTACTCCTCCAGCGACGGGCGCTAATGGCCTGTGCACCCACTGGATCCGGCAAAACGC 420

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     421 TGGCCTTCCTCACACCCATCATAAATGGCCTGAGGGCGCACAAGACAACTGGACTGAGAG 480

5589R-1.IR_full       481 CTCTGGTCCTTGCTCCCACTC 501
                          ||||||||||||||||||||| silico     481 CTCTGGTCCTTGCTCCCACTC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140752.1  CG5589-RA (CG5589), mRNA 
0.2   NM_143183.1  CG5948-RA (CG5948), mRNA 
0   11  NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   11  NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   12  21  NM_141758.3  CG6544-RA, transcript variant A (fau), mRNA 
0   NM_137299.1  CG5065-RA (CG5065), mRNA 
0   NM_134506.1  CG12531-RA (CG12531), mRNA 
0   NM_134860.2  CG9961-RA (CG9961), mRNA 
0   NM_132141.1  CG14431-RA (CG14431), mRNA 
0   NM_137068.2  CG13345-RA (RacGAP50C), mRNA 
0   NM_130601.2  CG32803-RA, transcript variant A (CG32803), mRNA 
0   NM_080144.1  CG15844-RA (Klp54D), mRNA 
0   NM_080162.3  CG9900-RB, transcript variant B (mit(1)15), mRNA 
0   NM_001038739.1  CG9900-RC, transcript variant C (mit(1)15), mRNA 
0   NM_168477.1  CG32092-RB (CG32092), mRNA 
0   NM_141964.2  CG6225-RA (CG6225), mRNA 
0   NM_164750.1  CG5973-RA, transcript variant A (CG5973), mRNA 
0   NM_142742.2  CG6332-RA (CG6332), mRNA 
0   NM_142277.1  CG10309-RA (pad), mRNA 
0   NM_136251.2  CG9246-RA (CG9246), mRNA 
0   10  NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_142461.2  CG14309-RA (CG14309), mRNA 
0   NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_141691.1  CG8500-RA (CG8500), mRNA 
0   NM_169095.1  CG1093-RB, transcript variant B (plx), mRNA 
0   NM_169094.1  CG1093-RA, transcript variant A (plx), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_137082.1  CG13353-RA (CG13353), mRNA 
0   NM_058091.3  CG3152-RA (Trap1), mRNA 
0   NM_134676.1  CG4213-RA (CG4213), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.