National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5574R-2 
 Symbol lea  Full Name leak 
 CG No CG5481  Old CG No CG5574 
 Synonyms robo2, Robo2, CG5481, Robo-2, Robo 2, CT17326, dRobo-2, robo-2, D-Robo2, D-robo2, clone 1.75, anon-EST:Liang-1.75, CG5574, CG14348, CG14347, lea 
 Accession No (Link to NCBI) NM_080531.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCAGCGAGATATACCCCACG 
 Primer Seq. 3'
aatctagaggtaccTGTGGGACCAGGGGAATCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCAGCGAGA TATACCCCAC GAACACGGGT CCTTCGCGCT CTGTCTACTC TGAGCAGTAT 
0061 TACTACCCCA AGGACAAGCA GAGACACATC CACATCACCG AGAACAAGCT GAGCAACTGC 
0121 CACACCTATG AGGCGGCTCC TGGCGCCAAG CAGTCCTCGC CGATATCCTC GCAGTTCGCC 
0181 AGCGTGAGGC GGCAGCAgCT GCCGCCCAAC TGCAGCATCG GCAGGGAAAG TGCCCGCTTC 
0241 AAGGTGCTAA ACACGGATCA GGGCAAGAAC CAGCAGAATC TCCTGGATCT CGACGGCTCC 
0301 TCGATGTGCT ACAACGGTCT GGCAGACTCG GGCTGCGGTG GATCTCCCTC CCCGATGGCC 
0361 ATGCTGATGT CGCACGAGGA CGAGCACGCG CTGTACCACA CGGCGGATGG GGATCTGGAC 
0421 GACATGGAAC GACTGTACGT CAAGGTGGAC GAGCAGCAGC CTCCACAGCA GCAGCAGCAG 
0481 CTGATTCCCC TGGTCCCACA  
 in silico PCR Fragment
0001 ACCAGCGAGA TATACCCCAC GAACACGGGT CCTTCGCGCT CTGTCTACTC TGAGCAGTAT 
0061 TACTACCCCA AGGACAAGCA GAGACACATC CACATCACCG AGAACAAGCT GAGCAACTGC 
0121 CACACCTATG AGGCGGCTCC TGGCGCCAAG CAGTCCTCGC CGATATCCTC GCAGTTCGCC 
0181 AGCGTGAGGC GGCAGCAGCT GCCGCCCAAC TGCAGCATCG GCAGGGAAAG TGCCCGCTTC 
0241 AAGGTGCTAA ACACGGATCA GGGCAAGAAC CAGCAGAATC TCCTGGATCT CGACGGCTCC 
0301 TCGATGTGCT ACAACGGTCT GGCAGACTCG GGCTGCGGTG GATCTCCCTC CCCGATGGCC 
0361 ATGCTGATGT CGCACGAGGA CGAGCACGCG CTGTACCACA CGGCGGATGG GGATCTGGAC 
0421 GACATGGAAC GACTGTACGT CAAGGTGGAC GAGCAGCAGC CTCCACAGCA GCAGCAGCAG 
0481 CTGATTCCCC TGGTCCCACA  
 Assemble Data

5574R-2.IR_full       1   ACCAGCGAGATATACCCCACGAACACGGGTCCTTCGCGCTCTGTCTACTCTGAGCAGTAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     1   ACCAGCGAGATATACCCCACGAACACGGGTCCTTCGCGCTCTGTCTACTCTGAGCAGTAT 60


5574R-2.IR_full       61  TACTACCCCAAGGACAAGCAGAGACACATCCACATCACCGAGAACAAGCTGAGCAACTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     61  TACTACCCCAAGGACAAGCAGAGACACATCCACATCACCGAGAACAAGCTGAGCAACTGC 120


5574R-2.IR_full       121 CACACCTATGAGGCGGCTCCTGGCGCCAAGCAGTCCTCGCCGATATCCTCGCAGTTCGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     121 CACACCTATGAGGCGGCTCCTGGCGCCAAGCAGTCCTCGCCGATATCCTCGCAGTTCGCC 180


5574R-2.IR_full       181 AGCGTGAGGCGGCAGCAGCTGCCGCCCAACTGCAGCATCGGCAGGGAAAGTGCCCGCTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     181 AGCGTGAGGCGGCAGCAGCTGCCGCCCAACTGCAGCATCGGCAGGGAAAGTGCCCGCTTC 240


5574R-2.IR_full       241 AAGGTGCTAAACACGGATCAGGGCAAGAACCAGCAGAATCTCCTGGATCTCGACGGCTCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     241 AAGGTGCTAAACACGGATCAGGGCAAGAACCAGCAGAATCTCCTGGATCTCGACGGCTCC 300


5574R-2.IR_full       301 TCGATGTGCTACAACGGTCTGGCAGACTCGGGCTGCGGTGGATCTCCCTCCCCGATGGCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     301 TCGATGTGCTACAACGGTCTGGCAGACTCGGGCTGCGGTGGATCTCCCTCCCCGATGGCC 360


5574R-2.IR_full       361 ATGCTGATGTCGCACGAGGACGAGCACGCGCTGTACCACACGGCGGATGGGGATCTGGAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     361 ATGCTGATGTCGCACGAGGACGAGCACGCGCTGTACCACACGGCGGATGGGGATCTGGAC 420


5574R-2.IR_full       421 GACATGGAACGACTGTACGTCAAGGTGGACGAGCAGCAGCCTCCACAGCAGCAGCAGCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5574R-2.in silico     421 GACATGGAACGACTGTACGTCAAGGTGGACGAGCAGCAGCCTCCACAGCAGCAGCAGCAG 480


5574R-2.IR_full       481 CTGATTCCCCTGGTCCCACA 500
                          ||||||||||||||||||||
5574R-2.in silico     481 CTGATTCCCCTGGTCCCACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  38  NM_080531.2  CG5481-RA (lea), mRNA 
0.62   10  42  NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0.62   10  42  NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0.41   19  43  NM_080212.1  CG5832-RA (Hmx), mRNA 
0.41   45  105  NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
0.41   45  105  NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
0.41   45  105  NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
0.41   45  105  NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
0.41   27  105  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
0.41   21  41  NM_001015268.1  CG40450-PB.3 (CG40450), mRNA 
0.41   21  40  NM_001015269.1  CG40450-PA.3 (CG40450), mRNA 
0.41   18  85  NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
0.2   16  46  178  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.2   16  41  137  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.2   10  26  79  NM_137081.2  CG30483-RA (Prosap), mRNA 
0.2   44  90  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0.2   19  54  NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0.2   13  63  NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0.2   13  63  NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0.2   19  38  NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0.2   38  164  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0.2   38  164  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0.2   16  42  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0.2   22  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0.2   22  NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0.2   20  NM_206138.1  CG15920-RB, transcript variant B (resilin), mRNA 
0.2   20  NM_137313.2  CG15920-RA, transcript variant A (resilin), mRNA 
0.2   59  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0.2   59  NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0.2   31  NM_176544.1  CG33193-RA (sav), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.