National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5571R-2 
 Symbol CG33969  Full Name CG33969 
 CG No CG33969  Old CG No CG5571 
 Synonyms CG5571, CG32429, CG33969 
 Accession No (Link to NCBI) NM_001038945.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGATGCACTGCATCGTCGCT 
 Primer Seq. 3'
aatctagaggtaccCGTGCTATCGAAGTTGGCCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGANTGCAC TGCATCGTCG CTTCGACGAG GTAGATCTGT ACGTCCGCAC AGACCGACAT 
0061 CTCCGATTTC GTCAAAAAGA ATGAAACCAT ATTCGCGGGA AGGGTTTGTG GATCGTGCTT 
0121 CCACTACGAC ACCGATAGCA TGGTGATGAC GGAGCAGAGG ATGCATCCGG CCAACGAATA 
0181 CTTGTACTGC GTAGACTTTG TCAAGGATCT GTACGCAACC AGCACAGATC ACTGCTGCAG 
0241 ACTGTGGCAG CGTGCGCAGG AGTTTGGAAT GACGCATTTT GATCAGGTGA TGCATCTGCC 
0301 GCACGCCTTT AGGTCTCTGG AACTCAGTTC GGATGGCCAG TGGCTGTATG GTGGACTATA 
0361 CACTGACAAC GGTCGCCAGG CCTTGAGGGC AGTCCATGTT GAAAGTGGCG AGGAATTGGT 
0421 GTTTAGTTCC AAAACAATGT CAATTTACGA CCTGAAATTG AAAGATGACC AGGTCATTTT 
0481 CACGGCCAAC TTCGATAGCA CG 
 in silico PCR Fragment
0001 GCGA-TGCAC TGCATCGTCG CTTCGACGAG G-AGATCTGT ACGTCCGCAC AGACCGACAT 
0061 CTCCGATTTC GTCAAAAAGA ATGAAACCAT ATTCGCGGGA AGGGTTTGTG GATCGTGCTT 
0121 CCACTACGAC ACCGATAGCA TGGTGATGAC GGAGCAGAGG ATGCATCCGG CCAACGAATA 
0181 CTTGTACTGC GTAGACTTTG TCAAGGATCT GTACGCAACC AGCACAGATC ACTGCTGCAG 
0241 ACTGTGGCAG CGTGCGCAGG AGTTTGGAAT GACGCATTTT GATCAGGTGA TGCATCTGCC 
0301 GCACGCCTTT AGGTCTCTGG AACTCAGTTC GGATGGCCAG TGGCTGTATG GTGGACTATA 
0361 CACTGACAAC GGTCGCCAGG CCTTGAGGGC AGTCCATGTT GAAAGTGGCG AGGAATTGGT 
0421 GTTTAGTTCC AAAACAATGT CAATTTACGA CCTGAAATTG AAAGATGACC AGGTCATTTT 
0481 CACGGCCAAC TTCGATAGCA CG 
 Assemble Data

5571R-2.IR_full       1   GCGANTGCACTGCATCGTCGCTTCGACGAGGTAGATCTGTACGTCCGCACAGACCGACAT 60
                          |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||
5571R-2.in silico     1   GCGA-TGCACTGCATCGTCGCTTCGACGAGG-AGATCTGTACGTCCGCACAGACCGACAT 60


5571R-2.IR_full       61  CTCCGATTTCGTCAAAAAGAATGAAACCATATTCGCGGGAAGGGTTTGTGGATCGTGCTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     61  CTCCGATTTCGTCAAAAAGAATGAAACCATATTCGCGGGAAGGGTTTGTGGATCGTGCTT 120


5571R-2.IR_full       121 CCACTACGACACCGATAGCATGGTGATGACGGAGCAGAGGATGCATCCGGCCAACGAATA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     121 CCACTACGACACCGATAGCATGGTGATGACGGAGCAGAGGATGCATCCGGCCAACGAATA 180


5571R-2.IR_full       181 CTTGTACTGCGTAGACTTTGTCAAGGATCTGTACGCAACCAGCACAGATCACTGCTGCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     181 CTTGTACTGCGTAGACTTTGTCAAGGATCTGTACGCAACCAGCACAGATCACTGCTGCAG 240


5571R-2.IR_full       241 ACTGTGGCAGCGTGCGCAGGAGTTTGGAATGACGCATTTTGATCAGGTGATGCATCTGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     241 ACTGTGGCAGCGTGCGCAGGAGTTTGGAATGACGCATTTTGATCAGGTGATGCATCTGCC 300


5571R-2.IR_full       301 GCACGCCTTTAGGTCTCTGGAACTCAGTTCGGATGGCCAGTGGCTGTATGGTGGACTATA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     301 GCACGCCTTTAGGTCTCTGGAACTCAGTTCGGATGGCCAGTGGCTGTATGGTGGACTATA 360


5571R-2.IR_full       361 CACTGACAACGGTCGCCAGGCCTTGAGGGCAGTCCATGTTGAAAGTGGCGAGGAATTGGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     361 CACTGACAACGGTCGCCAGGCCTTGAGGGCAGTCCATGTTGAAAGTGGCGAGGAATTGGT 420


5571R-2.IR_full       421 GTTTAGTTCCAAAACAATGTCAATTTACGACCTGAAATTGAAAGATGACCAGGTCATTTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5571R-2.in silico     421 GTTTAGTTCCAAAACAATGTCAATTTACGACCTGAAATTGAAAGATGACCAGGTCATTTT 480


5571R-2.IR_full       481 CACGGCCAACTTCGATAGCACG 502
                          ||||||||||||||||||||||
5571R-2.in silico     481 CACGGCCAACTTCGATAGCACG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038946.1  CG33969-RB, transcript variant B (CG33969), mRNA 
100   482  NM_001038945.1  CG33969-RA, transcript variant A (CG33969), mRNA 
0   NM_142674.2  CG10827-RA (CG10827), mRNA 
0   NM_140621.1  CG4998-RA, transcript variant A (CG4998), mRNA 
0   NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
0   14  NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
0   14  NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0   NM_080331.2  CG3578-RA (bi), mRNA 
0   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_205969.1  CG6214-RK, transcript variant K (MRP), mRNA 
0   NM_205974.1  CG6214-RF, transcript variant F (MRP), mRNA 
0   NM_169191.2  CG31146-RD (CG31146), mRNA 
0   NM_136025.1  CG5783-RA (CG5783), mRNA 
0   NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_141330.1  CG2051-RA, transcript variant A (CG2051), mRNA 
0   NM_169106.1  CG2051-RB, transcript variant B (CG2051), mRNA 
0   NM_165178.1  CG17332-RD, transcript variant D (VhaSFD), mRNA 
0   NM_078861.2  CG17332-RA, transcript variant A (VhaSFD), mRNA 
0   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_134276.1  CG8930-RC, transcript variant C (rk), mRNA 
0   NM_134275.1  CG8930-RB, transcript variant B (rk), mRNA 
0   NM_134277.1  CG8930-RD, transcript variant D (rk), mRNA 
0   NM_057354.2  CG8930-RA, transcript variant A (rk), mRNA 
0   NM_176034.1  CG8930-RE, transcript variant E (rk), mRNA 
0   NM_130515.2  CG3708-RA (CG3708), mRNA 
0   NM_079657.2  CG14904-RA (Scp2), mRNA 
0   NM_136583.2  CG8232-RA (CG8232), mRNA 
0   NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
0   NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.