National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5565R-3 
 Symbol CG5565  Full Name CG5565 
 CG No CG5565  Old CG No CG5565 
 Synonyms CG5565 
 Accession No (Link to NCBI) NM_134754.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCCACCAAGAAGTGTTAC 
 Primer Seq. 3'
aatctagaggtaccATTGAATCGCGAGGCGGCCAG 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ATGCCCACCA AGAAGTGTTA CTGCCCCGTC ACTCATGTCA TCTTTGACTG CGATGGAACC 
0061 TTGATAGATA GCGAAGGCAT CTACCTCAAA ACGGTTCAAG ACTTGTTGGC TAAATATGGC 
0121 AAAACGTACA CCAAAGTCGA TCAGACGCAG CATATGGGAA TGCCGGTCGG TACATTTTCC 
0181 CAACACATCG TCAAGGATCT AAAACTTCCG TTGTCACCTG CGGAATTTCA AAAGGAATTC 
0241 GAGGCAGCTG TTGATAAGAG CATGGGAAGT GTGGCTCTGC TGCCAGGGGT CAGGGATCTG 
0301 ATTCTCCACT TGCACGAATA CCGCATACCC TTCTGCATAG CCACAAGTTC GTTTAGGAAA 
0361 CTGTTCAAAG TGAAGGCCGA GTCCTTCAAG GATATATTCC TGGCCTTTCA CCACGTTGTC 
0421 TGTGGCGATG ATCCGGCACT TGGACCGGGA AGAGGAAAGC CCTACCCAGA TATATATCTC 
0481 CTGGCCGCCT CGCGATTCAA T 
 in silico PCR Fragment
0001 ATGCCCACCA AGAAGTGTTA CTGCCCCGTC ACTCATGTCA TCTTTGACTG CGATGGAACC 
0061 TTGATAGATA GCGAAGGCAT CTACCTCAAA ACGGTTCAAG ACTTGTTGGC TAAATATGGC 
0121 AAAACGTACA CCAAAGTCGA TCAGACGCAG CATATGGGAA TGCCGGTCGG TACATTTTCC 
0181 CAACACATCG TCAAGGATCT AAAACTTCCG TTGTCACCTG CGGAATTTCA AAAGGAATTC 
0241 GAGGCAGCTG TTGATAAGAG CATGGGAAGT GTGGCTCTGC TGCCAGGGGT CAGGGATCTG 
0301 ATTCTCCACT TGCACGAATA CCGCATACCC TTCTGCATAG CCACAAGTTC GTTTAGGAAA 
0361 CTGTTCAAAG TGAAGGCCGA GTCCTTCAAG GATATATTCC TGGCCTTTCA CCACGTTGTC 
0421 TGTGGCGATG ATCCGGCACT TGGACCGGGA AGAGGAAAGC CCTACCCAGA TATATATCTC 
0481 CTGGCCGCCT CGCGATTCAA T 
 Assemble Data

5565R-3.IR_full       1   ATGCCCACCAAGAAGTGTTACTGCCCCGTCACTCATGTCATCTTTGACTGCGATGGAACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     1   ATGCCCACCAAGAAGTGTTACTGCCCCGTCACTCATGTCATCTTTGACTGCGATGGAACC 60


5565R-3.IR_full       61  TTGATAGATAGCGAAGGCATCTACCTCAAAACGGTTCAAGACTTGTTGGCTAAATATGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     61  TTGATAGATAGCGAAGGCATCTACCTCAAAACGGTTCAAGACTTGTTGGCTAAATATGGC 120


5565R-3.IR_full       121 AAAACGTACACCAAAGTCGATCAGACGCAGCATATGGGAATGCCGGTCGGTACATTTTCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     121 AAAACGTACACCAAAGTCGATCAGACGCAGCATATGGGAATGCCGGTCGGTACATTTTCC 180


5565R-3.IR_full       181 CAACACATCGTCAAGGATCTAAAACTTCCGTTGTCACCTGCGGAATTTCAAAAGGAATTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     181 CAACACATCGTCAAGGATCTAAAACTTCCGTTGTCACCTGCGGAATTTCAAAAGGAATTC 240


5565R-3.IR_full       241 GAGGCAGCTGTTGATAAGAGCATGGGAAGTGTGGCTCTGCTGCCAGGGGTCAGGGATCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     241 GAGGCAGCTGTTGATAAGAGCATGGGAAGTGTGGCTCTGCTGCCAGGGGTCAGGGATCTG 300


5565R-3.IR_full       301 ATTCTCCACTTGCACGAATACCGCATACCCTTCTGCATAGCCACAAGTTCGTTTAGGAAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     301 ATTCTCCACTTGCACGAATACCGCATACCCTTCTGCATAGCCACAAGTTCGTTTAGGAAA 360


5565R-3.IR_full       361 CTGTTCAAAGTGAAGGCCGAGTCCTTCAAGGATATATTCCTGGCCTTTCACCACGTTGTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     361 CTGTTCAAAGTGAAGGCCGAGTCCTTCAAGGATATATTCCTGGCCTTTCACCACGTTGTC 420


5565R-3.IR_full       421 TGTGGCGATGATCCGGCACTTGGACCGGGAAGAGGAAAGCCCTACCCAGATATATATCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5565R-3.in silico     421 TGTGGCGATGATCCGGCACTTGGACCGGGAAGAGGAAAGCCCTACCCAGATATATATCTC 480


5565R-3.IR_full       481 CTGGCCGCCTCGCGATTCAAT 501
                          |||||||||||||||||||||
5565R-3.in silico     481 CTGGCCGCCTCGCGATTCAAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_134754.2  CG5565-RA (CG5565), mRNA 
0   NM_141255.2  CG12007-RA (CG12007), mRNA 
0   NM_164470.1  CG17234-RA (CG17234), mRNA 
0   NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 
0   NM_167574.1  CG32556-RA, transcript variant A (CG32556), mRNA 
0   NM_135944.2  CG4249-RA (c(2)M), mRNA 
0   NM_140494.1  CG13457-RB, transcript variant B (CG13457), mRNA 
0   NM_168610.1  CG13457-RA, transcript variant A (CG13457), mRNA 
0   NM_136074.2  CG10428-RA (CG10428), mRNA 
0   NM_132927.2  CG18358-RA (CG18358), mRNA 
0   NM_079901.2  CG10811-RA (eIF-4G), mRNA 
0   NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_141905.2  CG4848-RA (CG4848), mRNA 
0   NM_143054.2  CG11168-RA (CG11168), mRNA 
0   NM_135525.1  CG5604-RA (CG5604), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_132130.1  CG12796-RA (CG12796), mRNA 
0   NM_176462.1  CG31116-RD, transcript variant D (CG31116), mRNA 
0   NM_169431.2  CG31116-RC, transcript variant C (CG31116), mRNA 
0   NM_169432.2  CG31116-RA, transcript variant A (CG31116), mRNA 
0   NM_132967.1  CG5004-RA (CG5004), mRNA 
0   NM_166332.1  CG10737-RB, transcript variant B (CG10737), mRNA 
0   NM_166334.1  CG10737-RA, transcript variant A (CG10737), mRNA 
0   NM_166333.1  CG10737-RD, transcript variant D (CG10737), mRNA 
0   NM_001014538.1  CG10737-RE, transcript variant E (CG10737), mRNA 
0   NM_137554.2  CG10737-RC, transcript variant C (CG10737), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.