National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5565R-1 
 Symbol CG5565  Full Name CG5565 
 CG No CG5565  Old CG No CG5565 
 Synonyms CG5565 
 Accession No (Link to NCBI) NM_134754.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCCCACCAAGAAGTGTTACTGCCCCGTCACTCATGTCATCTTTGACTGCGATGGAACC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTGATAGATAGCGAAGGCATCTACCTCAAAACGGTTCAAGACTTGTTGGCTAAATATGGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAAACGTACACCAAAGTCGATCAGACGCAGCATATGGGAATGCCGGTCGGTACATTTTCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAACACATCGTCAAGGATCTAAAACTTCCGTTGTCACCTGCGGAATTTCAAAAGGAATTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAGGCAGCTGTTGATAAGAGCATGGGAAGTGTGGCTCTGCTGCCAGGGGTCAGGGATCTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATTCTCCACTTGCACGAATACCGCATACCCTTCTGCATAGCCACAAGTTCGTTTAGGAAA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGTTCAAAGTGAAGGCCGAGTCCTTCAAGGATATATTCCTGGCCTTTCACCACGTTGTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTGGCGATGATCCGGCACTTGGACCGGGAAGAGGAAAGCCCTACCCAGATATATATCTC 480

5565R-1.IR_full       481 CTGGCCGCCTCGCGATTCAAT 501
                          ||||||||||||||||||||| silico     481 CTGGCCGCCTCGCGATTCAAT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_134754.2  CG5565-RA (CG5565), mRNA 
0   NM_141255.2  CG12007-RA (CG12007), mRNA 
0   NM_164470.1  CG17234-RA (CG17234), mRNA 
0   NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 
0   NM_167574.1  CG32556-RA, transcript variant A (CG32556), mRNA 
0   NM_135944.2  CG4249-RA (c(2)M), mRNA 
0   NM_140494.1  CG13457-RB, transcript variant B (CG13457), mRNA 
0   NM_168610.1  CG13457-RA, transcript variant A (CG13457), mRNA 
0   NM_136074.2  CG10428-RA (CG10428), mRNA 
0   NM_132927.2  CG18358-RA (CG18358), mRNA 
0   NM_079901.2  CG10811-RA (eIF-4G), mRNA 
0   NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_141905.2  CG4848-RA (CG4848), mRNA 
0   NM_143054.2  CG11168-RA (CG11168), mRNA 
0   NM_135525.1  CG5604-RA (CG5604), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_132130.1  CG12796-RA (CG12796), mRNA 
0   NM_176462.1  CG31116-RD, transcript variant D (CG31116), mRNA 
0   NM_169431.2  CG31116-RC, transcript variant C (CG31116), mRNA 
0   NM_169432.2  CG31116-RA, transcript variant A (CG31116), mRNA 
0   NM_132967.1  CG5004-RA (CG5004), mRNA 
0   NM_166332.1  CG10737-RB, transcript variant B (CG10737), mRNA 
0   NM_166334.1  CG10737-RA, transcript variant A (CG10737), mRNA 
0   NM_166333.1  CG10737-RD, transcript variant D (CG10737), mRNA 
0   NM_001014538.1  CG10737-RE, transcript variant E (CG10737), mRNA 
0   NM_137554.2  CG10737-RC, transcript variant C (CG10737), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.