National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5561R-3 
 Symbol CG5561  Full Name CG5561 
 CG No CG5561  Old CG No CG5561 
 Synonyms CG5561 
 Accession No (Link to NCBI) NM_134752.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TACCGGAAGGCTCTCAAGGAACTGGTCCGTTGTTACGATAAGAGGATACCAGACATTTTA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CATGTCCAAAGTGGACCTATGACGATATCAGAGATGTCTGAACTTTTTTGCCGGAAGCTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GATATTCCGATGAGTTGGGAATCGTTTCGGTATGAACTTAACGAGCGAACCTCCCATTTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATTGCAAATCCCCCGTTTATGGATGGGATTGAGCGGCTTGTTCCGCACCTGCGCAATAGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCATGGAATTGGGCTTGATCACCTCCAGCAACGAGGCCAACTACTGCTCGAAGATCCGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCCGGGAGGACTTCTTTGAGAACTTCTCCACCGTGGTCTGTGCGGATGATCCGGAGTTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGGGCACCCAAACCCGAGCCCGACGTCTACCTGATTGCCATGTCGAGGCTAGGGGATGCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGACCTGATTGCACCCTGGTTTTCGATGGCACTCCCAAAGGAGTTCAGGCGGCGAGCGAT 480

5561R-3.IR_full       481 GCTCGACTGCCCGTCATAAT 500
                          |||||||||||||||||||| silico     481 GCTCGACTGCCCGTCATAAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134752.2  CG5561-RA (CG5561), mRNA 
2.28   11  12  17  NM_134751.1  CG5556-RA (CG5556), mRNA 
0   NM_142026.2  CG8863-RA, transcript variant A (CG8863), mRNA 
0   NM_169522.1  CG8863-RE, transcript variant E (CG8863), mRNA 
0   NM_169519.1  CG8863-RB, transcript variant B (CG8863), mRNA 
0   NM_169520.1  CG8863-RC, transcript variant C (CG8863), mRNA 
0   NM_169521.1  CG8863-RD, transcript variant D (CG8863), mRNA 
0   NM_057353.3  CG9668-RA (Rh4), mRNA 
0   NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0   NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
0   NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
0   NM_079746.4  CG5320-RA, transcript variant A (Gdh), mRNA 
0   NM_206551.1  CG5320-RF, transcript variant F (Gdh), mRNA 
0   NM_206550.1  CG5320-RE, transcript variant E (Gdh), mRNA 
0   NM_170101.1  CG5320-RB, transcript variant B (Gdh), mRNA 
0   NM_141939.2  CG5641-RA (CG5641), mRNA 
0   NM_168384.1  CG6718-RC, transcript variant C (CG6718), mRNA 
0   NM_140109.1  CG6718-RA, transcript variant A (CG6718), mRNA 
0   NM_168385.1  CG6718-RD, transcript variant D (CG6718), mRNA 
0   NM_168383.1  CG6718-RB, transcript variant B (CG6718), mRNA 
0   NM_137128.2  CG12864-RA, transcript variant A (Su(var)2-HP2), mRNA 
0   NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   NM_168706.1  CG3799-RC, transcript variant C (CG3799), mRNA 
0   NM_140685.4  CG3799-RA, transcript variant A (CG3799), mRNA 
0   NM_168705.1  CG3799-RB, transcript variant B (CG3799), mRNA 
0   NM_142552.2  CG6255-RA (CG6255), mRNA 
0   14  NM_175960.3  CG33196-RB (dp), mRNA 
0   13  NM_168725.2  CG13731-RA (CG13731), mRNA 
0   NM_134987.1  CG15431-RA (CG15431), mRNA 
0   NM_141196.1  CG9778-RA (CG9778), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.