National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5556R-2 
 Symbol CG5556  Full Name CG5556 
 CG No CG5556  Old CG No CG5556 
 Synonyms CG5556 
 Accession No (Link to NCBI) NM_134751.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCGATCTGGAGAGCGCCGTT 
 Primer Seq. 3'
aatctagaggtaccCCCTTAGGAGTGCCATCGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCGATCTGG AGAGCGCCGT TTTCGACACG CGTCATGTCT ATAAGAGGGC CGTAATTGAG 
0061 CTGGCTGCGA GTTATAACAA GATCATCCCC GAAGCGNTCC TDATAAAAAG CGGTCCCATG 
0121 GAAACGGCTG AGATGGCCGA GTTGANCTGC CGGAAATGCG ATCTCCCCGT GAGCTGGGAG 
0181 TCCTTTCGCT TTCAGCTAAA TGAGCGTACT TCCGACTTGA TTGCCAATCC CACCCTGATG 
0241 CCCGGAGTAG AGCGTTTGGT CACCCATTTG GGGAGGTGCT GTATGGGACT GGGGCTGATC 
0301 ACCTCGTGCT CCGAATCAAT GTATTGCACT AAGATTCGGG ATAGGGAGGA CTTTTTCCAA 
0361 ANTTTTTCAT CGGTGATATG CGCCGATGAT GCGGACTTAA AAGCTCCAAA GcCGGAACCG 
0421 GATGTCTATT TAATTGCCAT GAGACGGTTG GGAGATGCCG GACCAGATTG CACCCTGGTT 
0481 TTCGATGGCA CTCCTAAGGG  
 in silico PCR Fragment
0001 TTCGATCTGG AGAGCGCCGT TTTCGACACG CGTCATGTCT ATAAGAGGGC CGTAATTGAG 
0061 CTGGCTGCGA GTTATAACAA GATCATCCCC GAAGCGGTCC TGATAAAAAG CGGTCCCATG 
0121 GAAACGGCTG AGATGGCCGA GTTGATCTGC CGGAAATGCG ATCTCCCCGT GAGCTGGGAG 
0181 TCCTTTCGCT TTCAGCTAAA TGAGCGTACT TCCGACTTGA TTGCCAATCC CACCCTGATG 
0241 CCCGGAGTAG AGCGTTTGGT CACCCATTTG GGGAGGTGCT GTATGGGACT GGGGCTGATC 
0301 ACCTCGTGCT CCGAATCAAT GTATTGCACT AAGATTCGGG ATAGGGAGGA CTTTTTCCAA 
0361 AATTTTTCAT CGGTGATATG CGCCGATGAT GCGGACTTAA AAGCTCCAAA GCCGGAACCG 
0421 GATGTCTATT TAATTGCCAT GAGACGGTTG GGAGATGCCG GACCAGATTG CACCCTGGTT 
0481 TTCGATGGCA CTCCTAAGGG  
 Assemble Data

5556R-2.IR_full        1   TCGATCTGGAGAGCGCCGTTTTCGACACGCGTCATGTCTATAAGAGGGCCGTAATTGAG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5556R-2.in silico      1   TCGATCTGGAGAGCGCCGTTTTCGACACGCGTCATGTCTATAAGAGGGCCGTAATTGAG 59


5556R-2.IR_full       61  CTGGCTGCGAGTTATAACAAGATCATCCCCGAAGCGNTCCTDATAAAAAGCGGTCCCATG 119
                          |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||
5556R-2.in silico     61  CTGGCTGCGAGTTATAACAAGATCATCCCCGAAGCGGTCCTGATAAAAAGCGGTCCCATG 119


5556R-2.IR_full       121 GAAACGGCTGAGATGGCCGAGTTGANCTGCCGGAAATGCGATCTCCCCGTGAGCTGGGAG 179
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
5556R-2.in silico     121 GAAACGGCTGAGATGGCCGAGTTGATCTGCCGGAAATGCGATCTCCCCGTGAGCTGGGAG 179


5556R-2.IR_full       181 TCCTTTCGCTTTCAGCTAAATGAGCGTACTTCCGACTTGATTGCCAATCCCACCCTGATG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5556R-2.in silico     181 TCCTTTCGCTTTCAGCTAAATGAGCGTACTTCCGACTTGATTGCCAATCCCACCCTGATG 239


5556R-2.IR_full       241 CCCGGAGTAGAGCGTTTGGTCACCCATTTGGGGAGGTGCTGTATGGGACTGGGGCTGATC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5556R-2.in silico     241 CCCGGAGTAGAGCGTTTGGTCACCCATTTGGGGAGGTGCTGTATGGGACTGGGGCTGATC 299


5556R-2.IR_full       301 ACCTCGTGCTCCGAATCAATGTATTGCACTAAGATTCGGGATAGGGAGGACTTTTTCCAA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5556R-2.in silico     301 ACCTCGTGCTCCGAATCAATGTATTGCACTAAGATTCGGGATAGGGAGGACTTTTTCCAA 359


5556R-2.IR_full       361 ANTTTTTCATCGGTGATATGCGCCGATGATGCGGACTTAAAAGCTCCAAAGCCGGAACCG 419
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5556R-2.in silico     361 AATTTTTCATCGGTGATATGCGCCGATGATGCGGACTTAAAAGCTCCAAAGCCGGAACCG 419


5556R-2.IR_full       421 GATGTCTATTTAATTGCCATGAGACGGTTGGGAGATGCCGGACCAGATTGCACCCTGGTT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5556R-2.in silico     421 GATGTCTATTTAATTGCCATGAGACGGTTGGGAGATGCCGGACCAGATTGCACCCTGGTT 479


5556R-2.IR_full       481 TTCGATGGCACTCCTAAGGG 499
                          ||||||||||||||||||||
5556R-2.in silico     481 TTCGATGGCACTCCTAAGGG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134751.1  CG5556-RA (CG5556), mRNA 
2.28   11  NM_134752.2  CG5561-RA (CG5561), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_139851.1  CG14834-RA (CG14834), mRNA 
0   10  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_176167.1  CG33156-RB, transcript variant B (CG33156), mRNA 
0   NM_176166.1  CG33156-RE, transcript variant E (CG33156), mRNA 
0   NM_176165.1  CG33156-RA, transcript variant A (CG33156), mRNA 
0   NM_176168.1  CG33156-RC, transcript variant C (CG33156), mRNA 
0   NM_166752.1  CG1836-RB, transcript variant B (Rad23), mRNA 
0   NM_143661.2  CG1836-RA, transcript variant A (Rad23), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_164805.1  CG8049-RC, transcript variant C (Btk29A), mRNA 
0   NM_057398.3  CG8049-RA, transcript variant A (Btk29A), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_132788.2  CG9114-RA (CG9114), mRNA 
0   NM_142070.2  CG3050-RA, transcript variant A (Cyp6d5), mRNA 
0   NM_206199.1  CG33227-RB (CG33227), mRNA 
0   NM_137554.2  CG10737-RC, transcript variant C (CG10737), mRNA 
0   NM_078607.2  CG6157-RA (dah), mRNA 
0   NM_001014538.1  CG10737-RE, transcript variant E (CG10737), mRNA 
0   NM_166333.1  CG10737-RD, transcript variant D (CG10737), mRNA 
0   NM_166334.1  CG10737-RA, transcript variant A (CG10737), mRNA 
0   NM_166332.1  CG10737-RB, transcript variant B (CG10737), mRNA 
0   NM_143387.1  CG14523-RA (CG14523), mRNA 
0   NM_137370.3  CG14478-RB, transcript variant B (CG14478), mRNA 
0   NM_166229.2  CG14478-RA, transcript variant A (CG14478), mRNA 
0   NM_164413.2  CG31924-RA, transcript variant A (CG31924), mRNA 
0   NM_164414.2  CG31924-RB, transcript variant B (CG31924), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.