National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5528R-3 
 Symbol Toll-9  Full Name Toll-9 
 CG No CG5528  Old CG No CG5528 
 Synonyms dToll9, Toll 9, toll, dTLR9, Tl-9, Tl-5, Tak/Toll-like, CT17508, CG5528, Toll-9 
 Accession No (Link to NCBI) NM_140957.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGGGAAGCATACACCGAGTT 
 Primer Seq. 3'
aatctagaggtaccCCAAGCGGGACTCGTTTACAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGGGNAGCA TACACCGAGT TTTCGATCCA GGATgGCTTG ATAATAGAAC CAGATTCAGC 
0061 CACAACATCC AGCGAAGAGG CCGAAGAGGT CAGCAAGGAG AGAACGGACC TCAAATCCCT 
0121 CATGTTGAAG TACGAATCGG ATGATGGGAA CAGTTGTCTG CTGGATCTGA TCAAGGACGA 
0181 GGTGATATGG TGGCAGTTTC CCAACGGAAC CCTCAGGGAC AGCACAAAGA AATACGCGCA 
0241 CAAATTGTAT TTGGATCTAT CCCACGGTAA TCTTAAGGAC GACTCTGACC TATTCCGAGA 
0301 AGCGAAACTT TCGAGGAAGG TTACCATTTG GAGGACAGAA GTCTTCTCGG CCGCATTCAA 
0361 TACGTTGACT GCAGCTCCGT TCAGGACGCT CTACTCCATG AGGGAATCCT TGAAGCTTTT 
0421 ATCGCTGCGA GGAAATAACT TTGCTGAACT GATTCCAGAT GCTGAAGACT TTGCTCGATT 
0481 TGTAAACGAG TCCCNGGCTT NAGG 
 in silico PCR Fragment
0001 AAGGGAAGCA TACACCGAGT TTTCGATCCA GGATGGCTTG ATAATAGAAC CAGATTCAGC 
0061 CACAACATCC AGCGAAGAGG CCGAAGAGGT CAGCAAGGAG AGAACGGACC TCAAATCCCT 
0121 CATGTTGAAG TACGAATCGG ATGATGGGAA CAGTTGTCTG CTGGATCTGA TCAAGGACGA 
0181 GGTGATATGG TGGCAGTTTC CCAACGGAAC CCTCAGGGAC AGCACAAAGA AATACGCGCA 
0241 CAAATTGTAT TTGGATCTAT CCCACGGTAA TCTTAAGGAC GACTCTGACC TATTCCGAGA 
0301 AGCGAAACTT TCGAGGAAGG TTACCATTTG GAGGACAGAA GTCTTCTCGG CCGCATTCAA 
0361 TACGTTGACT GCAGCTCCGT TCAGGACGCT CTACTCCATG AGGGAATCCT TGAAGCTTTT 
0421 ATCGCTGCGA GGAAATAACT TTGCTGAACT GATTCCAGAT GCTGAAGACT TTGCTCGATT 
0481 TGTAAACGAG TCCC--GCTT --GG 
 Assemble Data

5528R-3.IR_full       1   AAGGGNAGCATACACCGAGTTTTCGATCCAGGATGGCTTGATAATAGAACCAGATTCAGC 60
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     1   AAGGGAAGCATACACCGAGTTTTCGATCCAGGATGGCTTGATAATAGAACCAGATTCAGC 60


5528R-3.IR_full       61  CACAACATCCAGCGAAGAGGCCGAAGAGGTCAGCAAGGAGAGAACGGACCTCAAATCCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     61  CACAACATCCAGCGAAGAGGCCGAAGAGGTCAGCAAGGAGAGAACGGACCTCAAATCCCT 120


5528R-3.IR_full       121 CATGTTGAAGTACGAATCGGATGATGGGAACAGTTGTCTGCTGGATCTGATCAAGGACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     121 CATGTTGAAGTACGAATCGGATGATGGGAACAGTTGTCTGCTGGATCTGATCAAGGACGA 180


5528R-3.IR_full       181 GGTGATATGGTGGCAGTTTCCCAACGGAACCCTCAGGGACAGCACAAAGAAATACGCGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     181 GGTGATATGGTGGCAGTTTCCCAACGGAACCCTCAGGGACAGCACAAAGAAATACGCGCA 240


5528R-3.IR_full       241 CAAATTGTATTTGGATCTATCCCACGGTAATCTTAAGGACGACTCTGACCTATTCCGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     241 CAAATTGTATTTGGATCTATCCCACGGTAATCTTAAGGACGACTCTGACCTATTCCGAGA 300


5528R-3.IR_full       301 AGCGAAACTTTCGAGGAAGGTTACCATTTGGAGGACAGAAGTCTTCTCGGCCGCATTCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     301 AGCGAAACTTTCGAGGAAGGTTACCATTTGGAGGACAGAAGTCTTCTCGGCCGCATTCAA 360


5528R-3.IR_full       361 TACGTTGACTGCAGCTCCGTTCAGGACGCTCTACTCCATGAGGGAATCCTTGAAGCTTTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     361 TACGTTGACTGCAGCTCCGTTCAGGACGCTCTACTCCATGAGGGAATCCTTGAAGCTTTT 420


5528R-3.IR_full       421 ATCGCTGCGAGGAAATAACTTTGCTGAACTGATTCCAGATGCTGAAGACTTTGCTCGATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5528R-3.in silico     421 ATCGCTGCGAGGAAATAACTTTGCTGAACTGATTCCAGATGCTGAAGACTTTGCTCGATT 480


5528R-3.IR_full       481 TGTAAACGAGTCCCNGGCTTNAGG 504
                          ||||||||||||||  ||||  ||
5528R-3.in silico     481 TGTAAACGAGTCCC--GCTT--GG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140957.2  CG5528-RA (Toll-9), mRNA 
0   NM_167959.1  CG1244-RC, transcript variant C (CG1244), mRNA 
0   NM_139476.1  CG1244-RA, transcript variant A (CG1244), mRNA 
0   NM_167958.1  CG1244-RB, transcript variant B (CG1244), mRNA 
0   NM_167960.1  CG1244-RD, transcript variant D (CG1244), mRNA 
0   NM_167962.1  CG1244-RF, transcript variant F (CG1244), mRNA 
0   NM_167961.1  CG1244-RE, transcript variant E (CG1244), mRNA 
0   NM_078699.2  CG1692-RA (mal), mRNA 
0   NM_133098.2  CG7053-RA (CG7053), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_167837.1  CG17129-RB, transcript variant B (CG17129), mRNA 
0   NM_138204.2  CG17129-RA, transcript variant A (CG17129), mRNA 
0   NM_167838.1  CG17129-RC, transcript variant C (CG17129), mRNA 
0   NM_140007.1  CG5747-RA (mfr), mRNA 
0   NM_001032089.1  CG33645-RA (CG33645), mRNA 
0   NM_164564.1  CG31957-RA (CG31957), mRNA 
0   NM_169461.1  CG10042-RB, transcript variant B (MBD-R2), mRNA 
0   NM_141921.1  CG10042-RA, transcript variant A (MBD-R2), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_079078.2  CG9707-RA (Acox57D-p), mRNA 
0   NM_058146.3  CG2706-RA (fs(1)Yb), mRNA 
0   NM_001014745.1  CG9210-RB, transcript variant B (Ac13E), mRNA 
0   NM_057951.2  CG9210-RA, transcript variant A (Ac13E), mRNA 
0   NM_137467.2  CG14502-RB, transcript variant B (CG14502), mRNA 
0   NM_135569.2  CG7456-RA (CG7456), mRNA 
0   NM_168655.1  CG32155-RA (CG32155), mRNA 
0   NM_142396.1  CG7397-RA (CG7397), mRNA 
0   NM_139983.2  CG32355-RA (CG32355), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.