National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5516R-2 
 Symbol CG5516  Full Name CG5516 
 CG No CG5516  Old CG No CG5516 
 Synonyms CG5516 
 Accession No (Link to NCBI) NM_142258.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGCCTAGCTGCCCGCAAAT 
 Primer Seq. 3'
aatctagaggtaccTTCAGGTGAACTCCCGGCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGGCCTAGC TGCCCGCAAA TTAGCGCAAA AGAAGAGATC CGCAAAGCAA GCAGCAGACT 
0061 TTCCCAATGG CATCCGGTGC CAGAAGTGCC TGCAGATCGG ACACTGGAGC TATGAGTGCA 
0121 AGGAGAAGCG CAAATACGTC CACCGGAGCT CGCGTACCAA GCAGCTAAGC AAGCGTATGT 
0181 CCCAAAAGGA GGCTGACGCA CCCAAGAACC AGGTGGAGGA GCACTCGGAA GTGGCTTCCT 
0241 CGGAAGGAAA GAAGGTCCGT CGAAAGCGGA AAACGAGCAA GAGCTCCTCG TCCTCCTCCA 
0301 GCTCGTCGGA CAGCTCAGAC AGCAGCAGCG ANATCGGGCT CCTCATCCGA ATCAGACTCG 
0361 AGCAGCTCCA GTTCGGATTC GGACGACGAG GAAGGCAGCT CGTCAGACTC CAGTGGAAGT 
0421 GGCTCGGACA GCGACAGCAG CGAGGATCAA AAGCAGGGAG CTCCACAAAA AAAGAAAAAA 
0481 CGAGCCGGGA GTTCACCTGA A 
 in silico PCR Fragment
0001 TGGGCCTAGC TGCCCGCAAA TTAGCGCAAA AGAAGAGATC CGCAAAGCAA GCAGCAGACT 
0061 TTCCCAATGG CATCCGGTGC CAGAAGTGCC TGCAGATCGG ACACTGGAGC TATGAGTGCA 
0121 AGGAGAAGCG CAAATACGTC CACCGGAGCT CGCGTACCAA GCAGCTAAGC AAGCGTATGT 
0181 CCCAAAAGGA GGCTGACGCA CCCAAGAACC AGGTGGAGGA GCACTCGGAA GTGGCTTCCT 
0241 CGGAAGGAAA GAAGGTCCGT CGAAAGCGGA AAACGAGCAA GAGCTCCTCG TCCTCCTCCA 
0301 GCTCGTCGGA CAGCTCAGAC AGCAGCAGCG A-ATCGGGCT CCTCATCCGA ATCAGACTCG 
0361 AGCAGCTCCA GTTCGGATTC GGACGACGAG GAAGGCAGCT CGTCAGACTC CAGTGGAAGT 
0421 GGCTCGGACA GCGACAGCAG CGAGGATCAA AAGCAGGGAG CTCCACAAAA AAAGAAAAAA 
0481 CGAGCCGGGA GTTCACCTGA A 
 Assemble Data

5516R-2.IR_full       1   TGGGCCTAGCTGCCCGCAAATTAGCGCAAAAGAAGAGATCCGCAAAGCAAGCAGCAGACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     1   TGGGCCTAGCTGCCCGCAAATTAGCGCAAAAGAAGAGATCCGCAAAGCAAGCAGCAGACT 60


5516R-2.IR_full       61  TTCCCAATGGCATCCGGTGCCAGAAGTGCCTGCAGATCGGACACTGGAGCTATGAGTGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     61  TTCCCAATGGCATCCGGTGCCAGAAGTGCCTGCAGATCGGACACTGGAGCTATGAGTGCA 120


5516R-2.IR_full       121 AGGAGAAGCGCAAATACGTCCACCGGAGCTCGCGTACCAAGCAGCTAAGCAAGCGTATGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     121 AGGAGAAGCGCAAATACGTCCACCGGAGCTCGCGTACCAAGCAGCTAAGCAAGCGTATGT 180


5516R-2.IR_full       181 CCCAAAAGGAGGCTGACGCACCCAAGAACCAGGTGGAGGAGCACTCGGAAGTGGCTTCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     181 CCCAAAAGGAGGCTGACGCACCCAAGAACCAGGTGGAGGAGCACTCGGAAGTGGCTTCCT 240


5516R-2.IR_full       241 CGGAAGGAAAGAAGGTCCGTCGAAAGCGGAAAACGAGCAAGAGCTCCTCGTCCTCCTCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     241 CGGAAGGAAAGAAGGTCCGTCGAAAGCGGAAAACGAGCAAGAGCTCCTCGTCCTCCTCCA 300


5516R-2.IR_full       301 GCTCGTCGGACAGCTCAGACAGCAGCAGCGANATCGGGCTCCTCATCCGAATCAGACTCG 360
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
5516R-2.in silico     301 GCTCGTCGGACAGCTCAGACAGCAGCAGCGA-ATCGGGCTCCTCATCCGAATCAGACTCG 360


5516R-2.IR_full       361 AGCAGCTCCAGTTCGGATTCGGACGACGAGGAAGGCAGCTCGTCAGACTCCAGTGGAAGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     361 AGCAGCTCCAGTTCGGATTCGGACGACGAGGAAGGCAGCTCGTCAGACTCCAGTGGAAGT 420


5516R-2.IR_full       421 GGCTCGGACAGCGACAGCAGCGAGGATCAAAAGCAGGGAGCTCCACAAAAAAAGAAAAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5516R-2.in silico     421 GGCTCGGACAGCGACAGCAGCGAGGATCAAAAGCAGGGAGCTCCACAAAAAAAGAAAAAA 480


5516R-2.IR_full       481 CGAGCCGGGAGTTCACCTGAA 501
                          |||||||||||||||||||||
5516R-2.in silico     481 CGAGCCGGGAGTTCACCTGAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142258.2  CG5516-RA (CG5516), mRNA 
0.2   13  NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0.2   13  NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0.2   13  NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0.2   NM_132926.1  CG13008-RA, transcript variant A (CG13008), mRNA 
0   10  NM_140883.1  CG8780-RA (tey), mRNA 
0   NM_141889.2  CG3169-RA (Spt3), mRNA 
0   NM_130559.2  CG14788-RA (l(1)G0431), mRNA 
0   NM_141194.2  CG9779-RA (CG9779), mRNA 
0   NM_166856.1  CG16983-RB, transcript variant B (skpA), mRNA 
0   NM_166857.1  CG16983-RC, transcript variant C (skpA), mRNA 
0   NM_001038729.1  CG16983-RH, transcript variant H (skpA), mRNA 
0   NM_166860.1  CG16983-RF, transcript variant F (skpA), mRNA 
0   NM_166859.1  CG16983-RE, transcript variant E (skpA), mRNA 
0   NM_058042.3  CG16983-RA, transcript variant A (skpA), mRNA 
0   NM_166858.1  CG16983-RD, transcript variant D (skpA), mRNA 
0   NM_166861.1  CG16983-RG, transcript variant G (skpA), mRNA 
0   NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_141423.2  CG2341-RA (Ccp84Ad), mRNA 
0   NM_132038.1  CG4052-RA (CG4052), mRNA 
0   NM_140213.3  CG7533-RC (chrb), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_136862.1  CG8271-RA (CG8271), mRNA 
0   12  NM_080323.2  CG10798-RA (dm), mRNA 
0   NM_166427.2  CG9415-RB, transcript variant B (Xbp1), mRNA 
0   NM_079983.2  CG9415-RA, transcript variant A (Xbp1), mRNA 
0   NM_079522.2  CG10281-RA (TfIIFalpha), mRNA 
0   NM_136527.1  CG14755-RA (CG14755), mRNA 
0   NM_165519.1  CG11166-RC, transcript variant C (CG11166), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.