National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5516R-1 
 Symbol CG5516  Full Name CG5516 
 CG No CG5516  Old CG No CG5516 
 Synonyms CG5516 
 Accession No (Link to NCBI) NM_142258.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal 
 Map Viewer
[Please submit your publication]
Kanda H, Igaki T, Okano H, Miura M.
Conserved metabolic energy production pathways govern Eiger/TNF-induced nonapoptotic cell death.
Proc. Natl. Acad. Sci. U.S.A. (2011) 108(47) 18977-82 [ PubMed ID = 22065747 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGGCCTAGCTGCCCGCAAATTAGCGCAAAAGAAGAGATCCGCAAAGCAAGCAGCAGACT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCCCAATGGCATCCGGTGCCAGAAGTGCCTGCAGATCGGACACTGGAGCTATGAGTGCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGGAGAAGCGCAAATACGTCCACCGGAGCTCGCGTACCAAGCAGCTAAGCAAGCGTATGT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCAAAAGGAGGCTGACGCACCCAAGAACCAGGTGGAGGAGCACTCGGAAGTGGCTTCCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGGAAGGAAAGAAGGTCCGTCGAAAGCGGAAAACGAGCAAGAGCTCCTCGTCCTCCTCCA 300

                          ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     301 GCTCGTCGGACAGCTCAGACAGCAGCAGCGA-ATCGGGCTCCTCATCCGAATCAGACTCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCAGCTCCAGTTCGGATTCGGACGACGAGGAAGGCAGCTCGTCAGACTCCAGTGGAAGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCTCGGACAGCGACAGCAGCGAGGATCAAAAGCAGGGAGCTCCACAAAAAAAGAAAAAA 480

5516R-1.IR_full       481 CGAGCCGGGAGTTCACCTGAA 501
                          ||||||||||||||||||||| silico     481 CGAGCCGGGAGTTCACCTGAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142258.2  CG5516-RA (CG5516), mRNA 
0.2   13  NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0.2   13  NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0.2   13  NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0.2   NM_132926.1  CG13008-RA, transcript variant A (CG13008), mRNA 
0   10  NM_140883.1  CG8780-RA (tey), mRNA 
0   NM_141889.2  CG3169-RA (Spt3), mRNA 
0   NM_130559.2  CG14788-RA (l(1)G0431), mRNA 
0   NM_141194.2  CG9779-RA (CG9779), mRNA 
0   NM_166856.1  CG16983-RB, transcript variant B (skpA), mRNA 
0   NM_166857.1  CG16983-RC, transcript variant C (skpA), mRNA 
0   NM_001038729.1  CG16983-RH, transcript variant H (skpA), mRNA 
0   NM_166860.1  CG16983-RF, transcript variant F (skpA), mRNA 
0   NM_166859.1  CG16983-RE, transcript variant E (skpA), mRNA 
0   NM_058042.3  CG16983-RA, transcript variant A (skpA), mRNA 
0   NM_166858.1  CG16983-RD, transcript variant D (skpA), mRNA 
0   NM_166861.1  CG16983-RG, transcript variant G (skpA), mRNA 
0   NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_141423.2  CG2341-RA (Ccp84Ad), mRNA 
0   NM_132038.1  CG4052-RA (CG4052), mRNA 
0   NM_140213.3  CG7533-RC (chrb), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_136862.1  CG8271-RA (CG8271), mRNA 
0   12  NM_080323.2  CG10798-RA (dm), mRNA 
0   NM_166427.2  CG9415-RB, transcript variant B (Xbp1), mRNA 
0   NM_079983.2  CG9415-RA, transcript variant A (Xbp1), mRNA 
0   NM_079522.2  CG10281-RA (TfIIFalpha), mRNA 
0   NM_136527.1  CG14755-RA (CG14755), mRNA 
0   NM_165519.1  CG11166-RC, transcript variant C (CG11166), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.