National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5497R-3 
 Symbol mRpS28  Full Name mitochondrial ribosomal protein S28 
 CG No CG5497  Old CG No CG5497 
 Synonyms MRP-S35, CG5497, BcDNA:RH13070, mRpS28 
 Accession No (Link to NCBI) NM_079061.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTCATTAACCTGTCGTTCCC 
 Primer Seq. 3'
aatctagaggtaccGTAATATCCTTGGACGAACCC 
 Predicted Fragment Size
445 
 IR fragment full Seq
0001 CTTCATTAAC CTGTCGTTCC CGAATGCCAA TGGTCATTCG ACTTATCAGC GGTAACACAG 
0061 AAAAACCGGC GGAGGAATCT ACTCCCGCAG TGAATACGGA AACGGCGGAG ATTGGCAGCA 
0121 GCAAGGGAGG ATTCGCCCGT GCCTTCGACA AGTACACGGC ACCAGNCACG CCTCCACAGC 
0181 TGCCGGAAGA CAACCAGACC TTCGCCTCCC TGCTGCGCAA CTCCAAATTA ATTGATCTGG 
0241 ACAACGcCGA GNGGCAAGGT GGTCAGTGGC AAGATCTTTC ATGTGGTGGG CGATGATCTC 
0301 TACATAGACT TTGGTTGGAA GTTTNCACTG CGTCTGCAGT CGTCCAACAC GCAATGCCAG 
0361 CGACTATGTG CGAGGAGCCC GTGTTCGACT GCGCATCAAG GACTTGGAGT TGTCCACCAA 
0421 GTTTCTGGGT TCGTCCAAGG ATATTAC 
 in silico PCR Fragment
0001 CTTCATTAAC CTGTCGTTCC CGAATGCCAA TGGTCATTCG ACTTATCAGC GGTAACACAG 
0061 AAAAACCGGC GGAGGAATCT ACTCCCGCAG TGAATACGGA AACGGCGGAG ATTGGCAGCA 
0121 GCAAGGGAGG ATTCGCCCGT GCCTTCGACA AGTACACGGC ACCAGCCACG CCTCCACAGC 
0181 TGCCGGAAGA CAACCAGACC TTCGCCTCCC TGCTGCGCAA CTCCAAATTA ATTGATCTGG 
0241 ACAACGCCGA G-GGCAAGGT GGTCAGTGGC AAGATCTTTC ATGTGGTGGG CGATGATCTC 
0301 TACATAGACT TTGGTTGGAA GTTT-CACTG CGTCTGCAGT CGTCCAACAC GCAATGCCAG 
0361 CGACTATGTG CGAGGAGCCC GTGTTCGACT GCGCATCAAG GACTTGGAGT TGTCCACCAA 
0421 GTTTCTGGGT TCGTCCAAGG ATATTAC 
 Assemble Data

5497R-3.IR_full       1   CTTCATTAACCTGTCGTTCCCGAATGCCAATGGTCATTCGACTTATCAGCGGTAACACAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5497R-3.in silico     1   CTTCATTAACCTGTCGTTCCCGAATGCCAATGGTCATTCGACTTATCAGCGGTAACACAG 60


5497R-3.IR_full       61  AAAAACCGGCGGAGGAATCTACTCCCGCAGTGAATACGGAAACGGCGGAGATTGGCAGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5497R-3.in silico     61  AAAAACCGGCGGAGGAATCTACTCCCGCAGTGAATACGGAAACGGCGGAGATTGGCAGCA 120


5497R-3.IR_full       121 GCAAGGGAGGATTCGCCCGTGCCTTCGACAAGTACACGGCACCAGNCACGCCTCCACAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
5497R-3.in silico     121 GCAAGGGAGGATTCGCCCGTGCCTTCGACAAGTACACGGCACCAGCCACGCCTCCACAGC 180


5497R-3.IR_full       181 TGCCGGAAGACAACCAGACCTTCGCCTCCCTGCTGCGCAACTCCAAATTAATTGATCTGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5497R-3.in silico     181 TGCCGGAAGACAACCAGACCTTCGCCTCCCTGCTGCGCAACTCCAAATTAATTGATCTGG 240


5497R-3.IR_full       241 ACAACGCCGAGNGGCAAGGTGGTCAGTGGCAAGATCTTTCATGTGGTGGGCGATGATCTC 300
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
5497R-3.in silico     241 ACAACGCCGAG-GGCAAGGTGGTCAGTGGCAAGATCTTTCATGTGGTGGGCGATGATCTC 300


5497R-3.IR_full       301 TACATAGACTTTGGTTGGAAGTTTNCACTGCGTCTGCAGTCGTCCAACACGCAATGCCAG 360
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
5497R-3.in silico     301 TACATAGACTTTGGTTGGAAGTTT-CACTGCGTCTGCAGTCGTCCAACACGCAATGCCAG 360


5497R-3.IR_full       361 CGACTATGTGCGAGGAGCCCGTGTTCGACTGCGCATCAAGGACTTGGAGTTGTCCACCAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5497R-3.in silico     361 CGACTATGTGCGAGGAGCCCGTGTTCGACTGCGCATCAAGGACTTGGAGTTGTCCACCAA 420


5497R-3.IR_full       421 GTTTCTGGGTTCGTCCAAGGATATTAC 447
                          |||||||||||||||||||||||||||
5497R-3.in silico     421 GTTTCTGGGTTCGTCCAAGGATATTAC 447

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   427  NM_079061.2  CG5497-RA (mRpS28), mRNA 
0.46   NM_136422.2  CG1845-RA (CG1845), mRNA 
0   NM_143705.2  CG12225-RA (Spt6), mRNA 
0   NM_176153.1  CG33013-RB (CG33013), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_167387.1  CG32611-RB (CG32611), mRNA 
0   NM_057916.3  CG3619-RA, transcript variant A (Dl), mRNA 
0   NM_176228.1  CG15088-RB, transcript variant B (CG15088), mRNA 
0   NM_137520.2  CG15088-RA, transcript variant A (CG15088), mRNA 
0   NM_141038.2  CG9389-RA (CG9389), mRNA 
0   NM_133112.1  CG7349-RA (CG7349), mRNA 
0   NM_057414.3  CG1389-RA (tor), mRNA 
0   NM_001014724.1  CG6986-RC, transcript variant C (CG6986), mRNA 
0   NM_167020.1  CG6986-RB, transcript variant B (CG6986), mRNA 
0   NM_001014723.1  CG6986-RD, transcript variant D (CG6986), mRNA 
0   NM_131955.1  CG6986-RA, transcript variant A (CG6986), mRNA 
0   NM_167909.2  CG7971-RC, transcript variant C (CG7971), mRNA 
0   NM_080125.2  CG4399-RB (east), mRNA 
0   NM_167558.1  CG32562-RA (xmas-2), mRNA 
0   NM_165353.2  CG9266-RB (CG9266), mRNA 
0   NM_168450.1  CG6210-RB, transcript variant B (srt), mRNA 
0   NM_140188.2  CG6210-RA, transcript variant A (srt), mRNA 
0   NM_169860.2  CG31221-RA, transcript variant A (CG31221), mRNA 
0   NM_169861.2  CG31221-RB, transcript variant B (CG31221), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0   NM_135039.1  CG3753-RA (Marcal1), mRNA 
0   10  NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   10  NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   10  NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.