National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5489R-2 
 Symbol Atg7  Full Name Autophagy-specific gene 7 
 CG No CG5489  Old CG No CG5489 
 Synonyms CG5489, Atg7 
 Accession No (Link to NCBI) NM_137506.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACTCGAAACGCTCCATTACT 
 Primer Seq. 3'
aatctagaggtaccAGGGAACTTAAACTACGGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACTCGAAAC GCTCCATTAC TGGACACTAC ACAAATCGTA ATGCAAGTGG ATGCCTTTTG 
0061 GAAGTAGACT ACACGGCCTA CAACAGANAT GGCAAAGCCT CCAAAATTCA GCCATTCCGC 
0121 TATAGGCACC ATCTACAATA AGAACACAAT CGAAGAGTTC AAGGCCCTGG ACAAATTACA 
0181 ACTGCTGGCC GATGAGGGCA AGGAACTGCT GGCTGATATG TGCAGTGGTG GCGCCTTGAG 
0241 AGATCCCAGT CTATTGACCC GGTTCTTTGT TCTCTCCTTT GCCGATTTAA AGTGTCACAG 
0301 CTACTACTAT TGGTTCGCCT TTCCGTGCCC GCTGACGCCC ACCTTAAAGC TTCAGGGAGC 
0361 CGTCCAAAAA CTGCGGGACT TGCCCAATAG TAGTAGCTAT ATAATGGCTC TAAAGGCCTT 
0421 ACCCACTGAG TCACAGAACT TCTTCATTCT GTATGCTAAT GTGGAGAAGA ACATTTTCGA 
0481 AGCCCGTAGT TTAAGTTCCC T 
 in silico PCR Fragment
0001 GACTCGAAAC GCTCCATTAC TGGACACTAC ACAAATCGTA ATGCAAGTGG ATGCCTTTTG 
0061 GAAGTAGACT ACACGGCCTA CAACAGA-AT GGCAAAGCCT CCAAAATTCA GCCATTCCGC 
0121 TATAGGCACC ATCTACAATA AGAACACAAT CGAAGAGTTC AAGGCCCTGG ACAAATTACA 
0181 ACTGCTGGCC GATGAGGGCA AGGAACTGCT GGCTGATATG TGCAGTGGTG GCGCCTTGAG 
0241 AGATCCCAGT CTATTGACCC GGTTCTTTGT TCTCTCCTTT GCCGATTTAA AGTGTCACAG 
0301 CTACTACTAT TGGTTCGCCT TTCCGTGCCC GCTGACGCCC ACCTTAAAGC TTCAGGGAGC 
0361 CGTCCAAAAA CTGCGGGACT TGCCCAATAG TAGTAGCTAT ATAATGGCTC TAAAGGCCTT 
0421 ACCCACTGAG TCACAGAACT TCTTCATTCT GTATGCTAAT GTGGAGAAGA ACATTTTCGA 
0481 AGCCCGTAGT TTAAGTTCCC T 
 Assemble Data

5489R-2.IR_full       1   GACTCGAAACGCTCCATTACTGGACACTACACAAATCGTAATGCAAGTGGATGCCTTTTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     1   GACTCGAAACGCTCCATTACTGGACACTACACAAATCGTAATGCAAGTGGATGCCTTTTG 60


5489R-2.IR_full       61  GAAGTAGACTACACGGCCTACAACAGANATGGCAAAGCCTCCAAAATTCAGCCATTCCGC 120
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
5489R-2.in silico     61  GAAGTAGACTACACGGCCTACAACAGA-ATGGCAAAGCCTCCAAAATTCAGCCATTCCGC 120


5489R-2.IR_full       121 TATAGGCACCATCTACAATAAGAACACAATCGAAGAGTTCAAGGCCCTGGACAAATTACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     121 TATAGGCACCATCTACAATAAGAACACAATCGAAGAGTTCAAGGCCCTGGACAAATTACA 180


5489R-2.IR_full       181 ACTGCTGGCCGATGAGGGCAAGGAACTGCTGGCTGATATGTGCAGTGGTGGCGCCTTGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     181 ACTGCTGGCCGATGAGGGCAAGGAACTGCTGGCTGATATGTGCAGTGGTGGCGCCTTGAG 240


5489R-2.IR_full       241 AGATCCCAGTCTATTGACCCGGTTCTTTGTTCTCTCCTTTGCCGATTTAAAGTGTCACAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     241 AGATCCCAGTCTATTGACCCGGTTCTTTGTTCTCTCCTTTGCCGATTTAAAGTGTCACAG 300


5489R-2.IR_full       301 CTACTACTATTGGTTCGCCTTTCCGTGCCCGCTGACGCCCACCTTAAAGCTTCAGGGAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     301 CTACTACTATTGGTTCGCCTTTCCGTGCCCGCTGACGCCCACCTTAAAGCTTCAGGGAGC 360


5489R-2.IR_full       361 CGTCCAAAAACTGCGGGACTTGCCCAATAGTAGTAGCTATATAATGGCTCTAAAGGCCTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     361 CGTCCAAAAACTGCGGGACTTGCCCAATAGTAGTAGCTATATAATGGCTCTAAAGGCCTT 420


5489R-2.IR_full       421 ACCCACTGAGTCACAGAACTTCTTCATTCTGTATGCTAATGTGGAGAAGAACATTTTCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5489R-2.in silico     421 ACCCACTGAGTCACAGAACTTCTTCATTCTGTATGCTAATGTGGAGAAGAACATTTTCGA 480


5489R-2.IR_full       481 AGCCCGTAGTTTAAGTTCCCT 501
                          |||||||||||||||||||||
5489R-2.in silico     481 AGCCCGTAGTTTAAGTTCCCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137506.2  CG5489-RA, transcript variant A (Atg7), mRNA 
14.1   68  NM_166298.1  CG5489-RB, transcript variant B (Atg7), mRNA 
0.41   NM_138085.2  CG4622-RA, transcript variant A (CG4622), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_141090.2  CG7158-RA (CG7158), mRNA 
0   NM_132181.1  CG1409-RA (CG1409), mRNA 
0   NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0   NM_001015230.1  CG40155-PA.3 (CG40155), mRNA 
0   NM_079106.2  CG4817-RA (Ssrp), mRNA 
0   NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_168686.1  CG9674-RB, transcript variant B (CG9674), mRNA 
0   NM_168687.1  CG9674-RC, transcript variant C (CG9674), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_134653.2  CG11454-RA (CG11454), mRNA 
0   NM_135509.3  CG5734-RA (CG5734), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.