National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5482R-2 
 Symbol CG5482  Full Name CG5482 
 CG No CG5482  Old CG No CG5482 
 Synonyms CG5482 
 Accession No (Link to NCBI) NM_137509.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGCGCACCTTACCTACGAA 
 Primer Seq. 3'
aatctagaggtaccGCCAAATCCGATTGAACGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATGCGCACC TTACCTACGA AATAGAGCTT CTGGATATCA AATACGAAGA ATTTGCGGAC 
0061 CTTAAGAGCT TTGAAATACT GCGCAAATAT GGTACGCGCA AGAAAGAACG TGCCAATTTC 
0121 TTTTACAAAC GCTCGGAGTT CACAACCGCC ATTCACCTGT ACAGACGTGC CCTCGACTTT 
0181 CTGGACAATC GTGATGGGGA TCCGGACTCC GAGTTCGACA AGGAAGACTT GGAGCTCTCG 
0241 AACAGTGACA CGCAGACCCT GCTAGAGGAT CGGTTGATCG TTTACAATAA CTTGGCAATG 
0301 ACTCAAATCA AGATTGCCGC TTATGACGCA GCTCTGCAGT CCGTGGAGCA TGTGCTGCGG 
0361 TGCCAGCCAA ATAACTCCAA AGCCTTGTAT CGCAAAGGAA GAATATTGGA GGGCAAAGCG 
0421 GACACCNAGG GTGCTATTAA GCTACTGCAA ANNGTGGCTA CTCTCGAACC CGAAAATCGA 
0481 GCCGTTCAAT CGGATTTGGC  
 in silico PCR Fragment
0001 GATGCGCACC TTACCTACGA AATAGAGCTT CTGGATATCA AATACGAAGA ATTTGCGGAC 
0061 CTTAAGAGCT TTGAAATACT GCGCAAATAT GGTACGCGCA AGAAAGAACG TGCCAATTTC 
0121 TTTTACAAAC GCTCGGAGTT CACAACCGCC ATTCACCTGT ACAGACGTGC CCTCGACTTT 
0181 CTGGACAATC GTGATGGGGA TCCGGACTCC GAGTTCGACA AGGAAGACTT GGAGCTCTCG 
0241 AACAGTGACA CGCAGACCCT GCTAGAGGAT CGGTTGATCG TTTACAATAA CTTGGCAATG 
0301 ACTCAAATCA AGATTGCCGC TTATGACGCA GCTCTGCAGT CCGTGGAGCA TGTGCTGCGG 
0361 TGCCAGCCAA ATAACTCCAA AGCCTTGTAT CGCAAAGGAA GAATATTGGA GGGCAAAGCG 
0421 GACACCCAGG GTGCTATTAA GCTACTGCAA AAAGTGGCTA CTCTCGAACC CGAAAATCGA 
0481 GCCGTTCAAT CGGATTTGGC  
 Assemble Data

5482R-2.IR_full       1   GATGCGCACCTTACCTACGAAATAGAGCTTCTGGATATCAAATACGAAGAATTTGCGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     1   GATGCGCACCTTACCTACGAAATAGAGCTTCTGGATATCAAATACGAAGAATTTGCGGAC 60


5482R-2.IR_full       61  CTTAAGAGCTTTGAAATACTGCGCAAATATGGTACGCGCAAGAAAGAACGTGCCAATTTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     61  CTTAAGAGCTTTGAAATACTGCGCAAATATGGTACGCGCAAGAAAGAACGTGCCAATTTC 120


5482R-2.IR_full       121 TTTTACAAACGCTCGGAGTTCACAACCGCCATTCACCTGTACAGACGTGCCCTCGACTTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     121 TTTTACAAACGCTCGGAGTTCACAACCGCCATTCACCTGTACAGACGTGCCCTCGACTTT 180


5482R-2.IR_full       181 CTGGACAATCGTGATGGGGATCCGGACTCCGAGTTCGACAAGGAAGACTTGGAGCTCTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     181 CTGGACAATCGTGATGGGGATCCGGACTCCGAGTTCGACAAGGAAGACTTGGAGCTCTCG 240


5482R-2.IR_full       241 AACAGTGACACGCAGACCCTGCTAGAGGATCGGTTGATCGTTTACAATAACTTGGCAATG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     241 AACAGTGACACGCAGACCCTGCTAGAGGATCGGTTGATCGTTTACAATAACTTGGCAATG 300


5482R-2.IR_full       301 ACTCAAATCAAGATTGCCGCTTATGACGCAGCTCTGCAGTCCGTGGAGCATGTGCTGCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     301 ACTCAAATCAAGATTGCCGCTTATGACGCAGCTCTGCAGTCCGTGGAGCATGTGCTGCGG 360


5482R-2.IR_full       361 TGCCAGCCAAATAACTCCAAAGCCTTGTATCGCAAAGGAAGAATATTGGAGGGCAAAGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5482R-2.in silico     361 TGCCAGCCAAATAACTCCAAAGCCTTGTATCGCAAAGGAAGAATATTGGAGGGCAAAGCG 420


5482R-2.IR_full       421 GACACCNAGGGTGCTATTAAGCTACTGCAAANNGTGGCTACTCTCGAACCCGAAAATCGA 480
                          |||||| ||||||||||||||||||||||||  |||||||||||||||||||||||||||
5482R-2.in silico     421 GACACCCAGGGTGCTATTAAGCTACTGCAAAAAGTGGCTACTCTCGAACCCGAAAATCGA 480


5482R-2.IR_full       481 GCCGTTCAATCGGATTTGGC 500
                          ||||||||||||||||||||
5482R-2.in silico     481 GCCGTTCAATCGGATTTGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137509.2  CG5482-RA (CG5482), mRNA 
0   13  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_143534.2  CG15533-RA (CG15533), mRNA 
0   NM_136292.1  CG15216-RA (CG15216), mRNA 
0   NM_079081.3  CG9874-RA (Tbp), mRNA 
0   NM_176161.1  CG33007-RA (CG33007), mRNA 
0   NM_167019.1  CG7010-RB, transcript variant B (l(1)G0334), mRNA 
0   NM_134591.2  CG1501-RA (unc), mRNA 
0   NM_141072.2  CG7177-RA (CG7177), mRNA 
0   NM_141691.1  CG8500-RA (CG8500), mRNA 
0   NM_140442.1  CG7906-RA (CG7906), mRNA 
0   NM_166098.1  CG30468-RA (CG30468), mRNA 
0   NM_142972.3  CG6204-RA (CG6204), mRNA 
0   NM_058073.3  CG17654-RA, transcript variant A (Eno), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 
0   NM_137822.2  CG13506-RA (CG13506), mRNA 
0   NM_143388.1  CG14527-RA (CG14527), mRNA 
0   NM_142760.1  CG13860-RA (CG13860), mRNA 
0   NM_167226.1  CG32686-RB, transcript variant B (CG32686), mRNA 
0   NM_167227.1  CG32686-RA, transcript variant A (CG32686), mRNA 
0   NM_206478.1  CG11466-RB, transcript variant B (Cyp9f2), mRNA 
0   NM_141932.2  CG11466-RA, transcript variant A (Cyp9f2), mRNA 
0   NM_143366.2  CG9986-RA (CG9986), mRNA 
0   NM_138043.3  CG3257-RA, transcript variant A (CG3257), mRNA 
0   NM_132030.1  CG15770-RA (CG15770), mRNA 
0   NM_164362.1  CG2674-RG, transcript variant G (M(2)21AB), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.