National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5397R-3 
 Symbol CG5397  Full Name CG5397 
 CG No CG5397  Old CG No CG5397 
 Synonyms CT16527, CG5397 
 Accession No (Link to NCBI) NM_134747.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGTGATCTTGGCCAGCTGC 
 Primer Seq. 3'
aatctagaggtaccCGATACTGAGGAGCCACCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGGTGATCT TGGCCAGCTG CAAGTCTGGC GGGGATGCGC ACGTTCGCGT GAAGCGGATA 
0061 GTGGGTGGCA AGCAGTCGAA GGCGCCGCCC GTCGATGATC CCGTGATCTT CGCGAGACTC 
0121 TTTGATCGCG ATGCGCGAGT GGNAGGGATT CCGAAATCCC AGCACGGGCA TTTACTCGTT 
0181 TCTGGGAATG CACTATGCGN AGCCACCTGT TGGTCCACTG AGATACTCCA GACCGGTGTA 
0241 CAAAAGGCTT GCTGGTGACT TCAATGCCAC CAAACATGGG CCCACCTTGT ATACAGCCGC 
0301 ATCCGCAGTT TCCCCAAAGG ATTATCGGCG ATGAGGATTG CCTGCTGCTG AACGTCTACA 
0361 CCCCGCAAAT GCCGGATGAG ACCACAGGGC TGCCAGTGTT CGTTTGGATT CACCCGGGTG 
0421 GCTATCGATA TGGATCGGCG GCCCAGTACG ATGCCACNCC tATGgcNCAA AGGGGCGCAA 
0481 TCGTGGTGGC TCCTCAGTAT CG 
 in silico PCR Fragment
0001 GTGGTGATCT TGGCCAGCTG CAAGTCTGGC GGGGATGCGC ACGTTCGCGT GAAGCGGATA 
0061 GTGGGTGGCA AGCAGTCGAA GGCGCCGCCC GTCGATGATC CCGTGATCTT CGCGAGACTC 
0121 TTTGATCGCG ATGCGCGAGT GG-AGGGATT CCGGAATCCC AGCACGGGCA TCTACTCCTT 
0181 TCTGGGAATG CACTACGCGG AGCCACCTGT TGGTCCACTG AGATACTCCA GACCGGTGTA 
0241 CAAAAGGCTG GCTGGTGACT TCAATGCCAC CAAACAT-GG CCCACCTTGT ATACAGCCGC 
0301 ATCCGCAGTT TCCTCAGAGG ATTATCGGCG ATGAGGATTG CCTGCTGCTG AACGTCTACA 
0361 CCCCGCAAAT GCCGGATGAG ACCACAGGGC TGCCAGTGTT CGTTTGGATT CACCCGGGTG 
0421 GCTATCGATA TGGATCGGCG GCCCAGTACG ATGCCACGCC TATGGCCCAA AGGGGCGCAA 
0481 TCGTGGTGGC TCCTCAGTAT CG 
 Assemble Data

5397R-3.IR_full       1   GTGGTGATCTTGGCCAGCTGCAAGTCTGGCGGGGATGCGCACGTTCGCGTGAAGCGGATA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5397R-3.in silico     1   GTGGTGATCTTGGCCAGCTGCAAGTCTGGCGGGGATGCGCACGTTCGCGTGAAGCGGATA 60


5397R-3.IR_full       61  GTGGGTGGCAAGCAGTCGAAGGCGCCGCCCGTCGATGATCCCGTGATCTTCGCGAGACTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5397R-3.in silico     61  GTGGGTGGCAAGCAGTCGAAGGCGCCGCCCGTCGATGATCCCGTGATCTTCGCGAGACTC 120


5397R-3.IR_full       121 TTTGATCGCGATGCGCGAGTGGNAGGGATTCCGAAATCCCAGCACGGGCATTTACTCGTT 180
                          |||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| ||
5397R-3.in silico     121 TTTGATCGCGATGCGCGAGTGG-AGGGATTCCGGAATCCCAGCACGGGCATCTACTCCTT 180


5397R-3.IR_full       181 TCTGGGAATGCACTATGCGNAGCCACCTGTTGGTCCACTGAGATACTCCAGACCGGTGTA 240
                          ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||
5397R-3.in silico     181 TCTGGGAATGCACTACGCGGAGCCACCTGTTGGTCCACTGAGATACTCCAGACCGGTGTA 240


5397R-3.IR_full       241 CAAAAGGCTTGCTGGTGACTTCAATGCCACCAAACATGGGCCCACCTTGTATACAGCCGC 300
                          ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||
5397R-3.in silico     241 CAAAAGGCTGGCTGGTGACTTCAATGCCACCAAACAT-GGCCCACCTTGTATACAGCCGC 300


5397R-3.IR_full       301 ATCCGCAGTTTCCCCAAAGGATTATCGGCGATGAGGATTGCCTGCTGCTGAACGTCTACA 360
                          ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||
5397R-3.in silico     301 ATCCGCAGTTTCCTCAGAGGATTATCGGCGATGAGGATTGCCTGCTGCTGAACGTCTACA 360


5397R-3.IR_full       361 CCCCGCAAATGCCGGATGAGACCACAGGGCTGCCAGTGTTCGTTTGGATTCACCCGGGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5397R-3.in silico     361 CCCCGCAAATGCCGGATGAGACCACAGGGCTGCCAGTGTTCGTTTGGATTCACCCGGGTG 420


5397R-3.IR_full       421 GCTATCGATATGGATCGGCGGCCCAGTACGATGCCACNCCTATGGCNCAAAGGGGCGCAA 480
                          ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
5397R-3.in silico     421 GCTATCGATATGGATCGGCGGCCCAGTACGATGCCACGCCTATGGCCCAAAGGGGCGCAA 480


5397R-3.IR_full       481 TCGTGGTGGCTCCTCAGTATCG 502
                          ||||||||||||||||||||||
5397R-3.in silico     481 TCGTGGTGGCTCCTCAGTATCG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134747.2  CG5397-RA (CG5397), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_132058.2  CG5966-RA (CG5966), mRNA 
0   NM_079034.2  CG8425-RA (Jhe), mRNA 
0   NM_078723.2  CG3022-RA, transcript variant A (GABA-B-R3), mRNA 
0   NM_164387.1  CG3022-RB, transcript variant B (GABA-B-R3), mRNA 
0   NM_134793.2  CG7291-RA (NPC2), mRNA 
0   NM_132650.1  CG10617-RA (CG10617), mRNA 
0   NM_139743.2  CG10483-RA (CG10483), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_139764.2  CG13295-RA (CG13295), mRNA 
0   NM_139623.2  CG1309-RA (CG1309), mRNA 
0   NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0   NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0   NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0   NM_134613.2  CG1644-RA (Cyp6t1), mRNA 
0   NM_166881.1  CG32813-RE, transcript variant E (CG32813), mRNA 
0   NM_001042903.1  CG7527-RB, transcript variant B (CadN2), mRNA 
0   NM_136011.2  CG7527-RA, transcript variant A (CadN2), mRNA 
0   NM_133070.1  CG15046-RA (CG15046), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_167875.1  CG9181-RD, transcript variant D (Ptp61F), mRNA 
0   NM_057339.3  CG9181-RA, transcript variant A (Ptp61F), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 
0   NM_078676.3  CG6223-RA (betaCop), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.