National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5392R-2 
 Symbol CG5392  Full Name CG5392 
 CG No CG5392  Old CG No CG5392 
 Synonyms CG5392 
 Accession No (Link to NCBI) NM_140476.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGAAATTCTCCTGTTCCTGC 
 Primer Seq. 3'
aatctagaggtaccCGACATGAGCCGAAGACCTGA 
 Predicted Fragment Size
352 
 IR fragment full Seq
0001 GGGAAATTCT CCTGTTCCTG CTGCCCTTCG GAGTGGTCAG TGCTGTCCGG CAGTTGGAGG 
0061 AAAATCAGAG CATCAAGAAT GATCACCATC ATTCGACGGA GCGACAGGTG CGACGCCGAA 
0121 ATAATAAAAG TAATGCCTCA GTGGATCACC ATCGGCATGC GCCATCTAGC GGATCAAAGA 
0181 AGAACAGTCG GAGCCATTCT GTAAGCCTGG ATTCGGATGA CTACGATTGG CTGGATGCGG 
0241 ATACTAGTGA GACAATCGAT AGCTCCGAGG TCACGGCTGT GGAATCCTAT AAGATCACCC 
0301 GGAGAATCAT ATGATATCTT CACATGTTGC AATCAGGTCT TCGGCTCATG TCG 
 in silico PCR Fragment
0001 GGGAAATTCT CCTGTTCCTG CTGCCCTTCG GAGTGGTCAG TGCTGTCCGG CAGTTGGAGG 
0061 AAAATCAGAG CATAAAGAAT GATCACCATC ATTCGGTGGA GCGACAGGTG CGACGTCGAA 
0121 ATAATAAAAG TAATGCCTCA GTGGATCACC ATCGGCATGC GCCATCTAGC GGATCAAAGA 
0181 AGAACAGTCG GAGCCATTCT GTAAGCCTGG ATTCGGATGA CTACGATTGG CTGGATGCGG 
0241 ATACTAGTGA GGCAATCGAT AGCTCCGAGG TCACGGCTGT GGAAT-CTAT AAGATCACCC 
0301 GGAGAATCAT ATGATATCTT CACATGTTGC AATCAGGTCT TCGGCTCATG TCG 
 Assemble Data

5392R-2.IR_full       1   GGGAAATTCTCCTGTTCCTGCTGCCCTTCGGAGTGGTCAGTGCTGTCCGGCAGTTGGAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5392R-2.in silico     1   GGGAAATTCTCCTGTTCCTGCTGCCCTTCGGAGTGGTCAGTGCTGTCCGGCAGTTGGAGG 60


5392R-2.IR_full       61  AAAATCAGAGCATCAAGAATGATCACCATCATTCGACGGAGCGACAGGTGCGACGCCGAA 120
                          ||||||||||||| |||||||||||||||||||||  |||||||||||||||||| ||||
5392R-2.in silico     61  AAAATCAGAGCATAAAGAATGATCACCATCATTCGGTGGAGCGACAGGTGCGACGTCGAA 120


5392R-2.IR_full       121 ATAATAAAAGTAATGCCTCAGTGGATCACCATCGGCATGCGCCATCTAGCGGATCAAAGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5392R-2.in silico     121 ATAATAAAAGTAATGCCTCAGTGGATCACCATCGGCATGCGCCATCTAGCGGATCAAAGA 180


5392R-2.IR_full       181 AGAACAGTCGGAGCCATTCTGTAAGCCTGGATTCGGATGACTACGATTGGCTGGATGCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5392R-2.in silico     181 AGAACAGTCGGAGCCATTCTGTAAGCCTGGATTCGGATGACTACGATTGGCTGGATGCGG 240


5392R-2.IR_full       241 ATACTAGTGAGACAATCGATAGCTCCGAGGTCACGGCTGTGGAATCCTATAAGATCACCC 300
                          ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||
5392R-2.in silico     241 ATACTAGTGAGGCAATCGATAGCTCCGAGGTCACGGCTGTGGAAT-CTATAAGATCACCC 300


5392R-2.IR_full       301 GGAGAATCATATGATATCTTCACATGTTGCAATCAGGTCTTCGGCTCATGTCG 353
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||
5392R-2.in silico     301 GGAGAATCATATGATATCTTCACATGTTGCAATCAGGTCTTCGGCTCATGTCG 353

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   334  NM_140476.2  CG5392-RA (CG5392), mRNA 
0   NM_141667.2  CG8358-RA (CG8358), mRNA 
0   NM_130673.2  CG32795-RB, transcript variant B (CG32795), mRNA 
0   NM_206617.1  CG32795-RC, transcript variant C (CG32795), mRNA 
0   NM_166952.1  CG32795-RA, transcript variant A (CG32795), mRNA 
0   NM_001043267.1  CG34118-RA (CG34118), mRNA 
0   NM_144308.1  CG18666-RA (CG18666), mRNA 
0   NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   NM_164441.1  CG31933-RA (CG31933), mRNA 
0   NM_080022.2  CG2841-RB, transcript variant B (ptr), mRNA 
0   NM_166937.1  CG2841-RA, transcript variant A (ptr), mRNA 
0   NM_166938.1  CG2841-RC, transcript variant C (ptr), mRNA 
0   NM_140769.1  CG5290-RA (CG5290), mRNA 
0   NM_130594.1  CG14803-RA (CG14803), mRNA 
0   NM_078698.2  CG1676-RA (cactin), mRNA 
0   NM_206051.1  CG2105-RB, transcript variant B (Corin), mRNA 
0   NM_136453.1  CG2105-RA, transcript variant A (Corin), mRNA 
0   NM_058037.3  CG9677-RA (Int6), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_168801.1  CG9279-RB, transcript variant B (CG9279), mRNA 
0   NM_140867.1  CG9279-RA, transcript variant A (CG9279), mRNA 
0   NM_141451.2  CG14608-RA (CG14608), mRNA 
0   NM_137460.2  CG5726-RA (CG5726), mRNA 
0   NM_141693.2  CG8507-RA (CG8507), mRNA 
0   NM_130517.2  CG3026-RA (mus81), mRNA 
0   NM_165270.1  CG31792-RA (CG31792), mRNA 
0   NM_079196.2  CG1232-RA, transcript variant A (tipE), mRNA 
0   NM_168067.1  CG1232-RB, transcript variant B (tipE), mRNA 
0   NM_132642.2  CG15744-RA (CG15744), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.