National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5360R-1 
 Symbol CG5360  Full Name CG5360 
 CG No CG5360  Old CG No CG5360 
 Synonyms CG5360 
 Accession No (Link to NCBI) NM_137959.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACGAATCGGAGCCTTCTACA 
 Primer Seq. 3'
aatctagaggtaccGACAGACGTGGATTCGTAGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACGAATCGG AGCCTTCTAC AGGAAGCGGG TCTTCGCTCA GTGAAAACAA TGAGAGCCAC 
0061 ATATCTGACG AGGATCACAT GAACTTACCG TATCTGATGA AACCGAAAGC ACTGAGCAGC 
0121 CAGCCCATCA AGGAAACCCC AACGCCACCC AATCCGAAGA CGGGCAGCCA GGAATCGCAG 
0181 TTCCTGGGCT TCGGAGACAG CCCATATGGC CAGGTGAACA AGCGTCTGTA TGGCTCCCAG 
0241 CTGCAGAACC TTAAGCTGCC GGAAGGTGGA AGCCCCCTGC CGTTCCGACG TCCCTCGCCG 
0301 GGCAAGATTG TCTTTCCCCG GTTCTACGAC ACCCTCATCG AGGAGAACAG CTGCAATGCC 
0361 GTGGACATGG CCGTGTCAGT GGCCACGACA GCCACCACGA CAACGGGCAG CCTCTCCTTC 
0421 GATGGCAAAA TCAAGAGCCT GACCGCAAAG CCCGAAATTC AGGACAAGCC TGGGCCCTCC 
0481 AATGCTACGA ATCCACGTCT GTC 
 in silico PCR Fragment
0001 TACGAATCGG AGCCTTCTAC AGGAAGCGGG TCTTCGCTCA GTGAAAACAA TGAGAGCCAC 
0061 ATATCTGACG AGGATCACAT GAACTTACCG TATCTGATGA AACCGAAAGC ACTGAGCAGC 
0121 CAGCCCATCA AGGAAACCCC AACGCCACCC AATCCGAAGA CGGGCAGCCA GGAATCGCAG 
0181 TTCCTGGGCT TCGGAGACAG CCCATATGGC CAGGTGAACA AGCGTCTGTA TGGCTCCCAG 
0241 CTGCAGAACC TTAAGCTGCC GGA-GGTGG- AGCCCCCTGC CG-TCCGACG TCCCTCGCCG 
0301 GGCAAGATTG TCTTTCCCCG GTTCTACGAC ACCCTCATCG AGGAGAACAG CTGCAATGCC 
0361 GTGGACATGG CCGTGTCAGT GGCCACGACA GCCACCACGA CAACGGGCAG CCTCTCCTTC 
0421 GATGGCAAAA TCAAGAGCCT GACCGCAAAG CCCGAAATTC AGGACAAGCC TGGGCCCTCC 
0481 AATGCTACGA ATCCACGTCT GTC 
 Assemble Data

5360R-1.IR_full       1   TACGAATCGGAGCCTTCTACAGGAAGCGGGTCTTCGCTCAGTGAAAACAATGAGAGCCAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     1   TACGAATCGGAGCCTTCTACAGGAAGCGGGTCTTCGCTCAGTGAAAACAATGAGAGCCAC 60


5360R-1.IR_full       61  ATATCTGACGAGGATCACATGAACTTACCGTATCTGATGAAACCGAAAGCACTGAGCAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     61  ATATCTGACGAGGATCACATGAACTTACCGTATCTGATGAAACCGAAAGCACTGAGCAGC 120


5360R-1.IR_full       121 CAGCCCATCAAGGAAACCCCAACGCCACCCAATCCGAAGACGGGCAGCCAGGAATCGCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     121 CAGCCCATCAAGGAAACCCCAACGCCACCCAATCCGAAGACGGGCAGCCAGGAATCGCAG 180


5360R-1.IR_full       181 TTCCTGGGCTTCGGAGACAGCCCATATGGCCAGGTGAACAAGCGTCTGTATGGCTCCCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     181 TTCCTGGGCTTCGGAGACAGCCCATATGGCCAGGTGAACAAGCGTCTGTATGGCTCCCAG 240


5360R-1.IR_full       241 CTGCAGAACCTTAAGCTGCCGGAAGGTGGAAGCCCCCTGCCGTTCCGACGTCCCTCGCCG 300
                          ||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||
5360R-1.in silico     241 CTGCAGAACCTTAAGCTGCCGGA-GGTGG-AGCCCCCTGCCG-TCCGACGTCCCTCGCCG 300


5360R-1.IR_full       301 GGCAAGATTGTCTTTCCCCGGTTCTACGACACCCTCATCGAGGAGAACAGCTGCAATGCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     301 GGCAAGATTGTCTTTCCCCGGTTCTACGACACCCTCATCGAGGAGAACAGCTGCAATGCC 360


5360R-1.IR_full       361 GTGGACATGGCCGTGTCAGTGGCCACGACAGCCACCACGACAACGGGCAGCCTCTCCTTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     361 GTGGACATGGCCGTGTCAGTGGCCACGACAGCCACCACGACAACGGGCAGCCTCTCCTTC 420


5360R-1.IR_full       421 GATGGCAAAATCAAGAGCCTGACCGCAAAGCCCGAAATTCAGGACAAGCCTGGGCCCTCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5360R-1.in silico     421 GATGGCAAAATCAAGAGCCTGACCGCAAAGCCCGAAATTCAGGACAAGCCTGGGCCCTCC 480


5360R-1.IR_full       481 AATGCTACGAATCCACGTCTGTC 503
                          |||||||||||||||||||||||
5360R-1.in silico     481 AATGCTACGAATCCACGTCTGTC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137959.1  CG5360-RA (CG5360), mRNA 
0   NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 
0   NM_136054.2  CG10341-RA (CG10341), mRNA 
0   13  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_137371.2  CG6522-RA (CG6522), mRNA 
0   NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_079841.2  CG17957-RA (Sry-alpha), mRNA 
0   NM_130642.1  CG14050-RA (CG14050), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_132905.2  CG9902-RA (CG9902), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_169916.1  CG10498-RA, transcript variant A (cdc2c), mRNA 
0   NM_079696.4  CG10498-RB, transcript variant B (cdc2c), mRNA 
0   NM_135087.1  CG7371-RA (CG7371), mRNA 
0   NM_130675.1  CG14416-RA (CG14416), mRNA 
0   NM_206752.1  CG9163-RB, transcript variant B (mmd), mRNA 
0   NM_136110.2  CG17564-RB (CG17564), mRNA 
0   NM_078634.2  CG9163-RA, transcript variant A (mmd), mRNA 
0   12  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   11  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_136332.2  CG8426-RA (l(2)NC136), mRNA 
0   NM_079972.3  CG4311-RA, transcript variant A (Hmgs), mRNA 
0   NM_166167.2  CG4311-RC, transcript variant C (Hmgs), mRNA 
0   NM_166166.2  CG4311-RB, transcript variant B (Hmgs), mRNA 
0   NM_166168.2  CG4311-RD, transcript variant D (Hmgs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.