National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5347R-3 
 Symbol CG5347  Full Name CG5347 
 CG No CG5347  Old CG No CG5347 
 Synonyms CG5347 
 Accession No (Link to NCBI) NM_132742.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCGTATCGCCGTAGTCAAAC 
 Primer Seq. 3'
aatctagaggtaccCGACGGTATCGAAACAAATGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCGTATCGC CGTAGTCAAA CAATCTGTCG CTTCCATTTG CTTGGAATTT GTCGTTTTGG 
0061 TGATTTATGC CGATTCTCGC ACGACGAGAC GACACCAAAT GACAACCAGA GTCCGCAGAT 
0121 ATCGGAAATC GCGGATGAAG TCGTGGAGAA TGAGCAAGTG GTGGCCTCCA CCAGNTAGCT 
0181 ACAGTCGCCA GATGACCTGG GCAAATGCAC CAGAGTTTGT TCCCAGGTAC AAAGCCAATT 
0241 CTGCCGATTT CCAAGCAACT GAAGGTGTCC AGGATATTTG TCCATATGGT GGCAGCTGTA 
0301 TCTGGGGCAG TAAGTGCTCG TATCCACTTC ACATGGAGAT TTGCAAGATG TGCGACCTTT 
0361 ACTGCCTCCA CCCGATGGAT CAGAACCAAC GCCGTGCGCA CAATCGTGAG TGTCTGGAGC 
0421 AGCACGAGCA GGCGATGGAG CTATCTTTTG CAATAGCCAG ATCCAAGGAC AAGATGTGCG 
0481 GCATTTGTTT CGATACCGTC G 
 in silico PCR Fragment
0001 GTCGTATCGC CGTAGTCAAA CAATCTGTCG CTTCCATTTG CTTGGAATTT GTCGTTTTGG 
0061 TGATTTATGC CGATTCTCGC ACGACGAGAC GACACCAAAT GACAACCAGA GTCCGCAGAT 
0121 ATCGGAAATC GCGGATGAAG TCGTGGAGAA TGAGCAAGTG GTGGCCTCCA CCAG-TAGCT 
0181 ACAGTCGCCA GATGACCTGG GCAAATGCAC CAGAGTTTGT TCCCAGGTAC AAAGCCAATT 
0241 CTGCCGATTT CCAAGCAACT GAAGGTGTCC AGGATATTTG TCCATATGGT GGCAGCTGTA 
0301 TCTGGGGCAG TAAGTGCTCG TATCCACTTC ACATGGAGAT TTGCAAGATG TGCGACCTTT 
0361 ACTGCCTCCA CCCGATGGAT CAGAACCAAC GCCGTGCGCA CAATCGTGAG TGTCTGGAGC 
0421 AGCACGAGCA GGCGATGGAG CTATCTTTTG CAATAGCCAG ATCCAAGGAC AAGATGTGCG 
0481 GCATTTGTTT CGATACCGTC G 
 Assemble Data

5347R-3.IR_full       1   GTCGTATCGCCGTAGTCAAACAATCTGTCGCTTCCATTTGCTTGGAATTTGTCGTTTTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     1   GTCGTATCGCCGTAGTCAAACAATCTGTCGCTTCCATTTGCTTGGAATTTGTCGTTTTGG 60


5347R-3.IR_full       61  TGATTTATGCCGATTCTCGCACGACGAGACGACACCAAATGACAACCAGAGTCCGCAGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     61  TGATTTATGCCGATTCTCGCACGACGAGACGACACCAAATGACAACCAGAGTCCGCAGAT 120


5347R-3.IR_full       121 ATCGGAAATCGCGGATGAAGTCGTGGAGAATGAGCAAGTGGTGGCCTCCACCAGNTAGCT 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
5347R-3.in silico     121 ATCGGAAATCGCGGATGAAGTCGTGGAGAATGAGCAAGTGGTGGCCTCCACCAG-TAGCT 180


5347R-3.IR_full       181 ACAGTCGCCAGATGACCTGGGCAAATGCACCAGAGTTTGTTCCCAGGTACAAAGCCAATT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     181 ACAGTCGCCAGATGACCTGGGCAAATGCACCAGAGTTTGTTCCCAGGTACAAAGCCAATT 240


5347R-3.IR_full       241 CTGCCGATTTCCAAGCAACTGAAGGTGTCCAGGATATTTGTCCATATGGTGGCAGCTGTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     241 CTGCCGATTTCCAAGCAACTGAAGGTGTCCAGGATATTTGTCCATATGGTGGCAGCTGTA 300


5347R-3.IR_full       301 TCTGGGGCAGTAAGTGCTCGTATCCACTTCACATGGAGATTTGCAAGATGTGCGACCTTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     301 TCTGGGGCAGTAAGTGCTCGTATCCACTTCACATGGAGATTTGCAAGATGTGCGACCTTT 360


5347R-3.IR_full       361 ACTGCCTCCACCCGATGGATCAGAACCAACGCCGTGCGCACAATCGTGAGTGTCTGGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     361 ACTGCCTCCACCCGATGGATCAGAACCAACGCCGTGCGCACAATCGTGAGTGTCTGGAGC 420


5347R-3.IR_full       421 AGCACGAGCAGGCGATGGAGCTATCTTTTGCAATAGCCAGATCCAAGGACAAGATGTGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5347R-3.in silico     421 AGCACGAGCAGGCGATGGAGCTATCTTTTGCAATAGCCAGATCCAAGGACAAGATGTGCG 480


5347R-3.IR_full       481 GCATTTGTTTCGATACCGTCG 501
                          |||||||||||||||||||||
5347R-3.in silico     481 GCATTTGTTTCGATACCGTCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132742.1  CG5347-RA (CG5347), mRNA 
1.45   12  73  40  NM_132741.1  CG5334-RA (CG5334), mRNA 
0.2   20  12  26  NM_168922.1  CG7184-RB, transcript variant B (Mkrn1), mRNA 
0.2   20  12  26  NM_079965.2  CG7184-RA, transcript variant A (Mkrn1), mRNA 
0   14  NM_140798.1  CG12477-RA (CG12477), mRNA 
0   NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0   NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0   NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0   NM_206671.1  CG9113-RE, transcript variant E (AP-1gamma), mRNA 
0   NM_132299.3  CG9113-RA, transcript variant A (AP-1gamma), mRNA 
0   NM_176717.1  CG9113-RC, transcript variant C (AP-1gamma), mRNA 
0   NM_167178.2  CG9113-RB, transcript variant B (AP-1gamma), mRNA 
0   NM_176718.1  CG9113-RD, transcript variant D (AP-1gamma), mRNA 
0   NM_139921.2  CG7972-RA (mus301), mRNA 
0   NM_132587.2  CG11085-RA (CG11085), mRNA 
0   NM_141936.1  CG6525-RA (CG6525), mRNA 
0   NM_001043106.1  CG9380-RC, transcript variant C (CG9380), mRNA 
0   NM_141084.2  CG7162-RA (MED1), mRNA 
0   NM_167326.1  CG1848-RA, transcript variant A (LIMK1), mRNA 
0   NM_078584.2  CG1848-RC, transcript variant C (LIMK1), mRNA 
0   NM_078530.2  CG11202-RA (org-1), mRNA 
0   NM_134504.2  CG14232-RA (CG14232), mRNA 
0   NM_058057.4  CG11143-RA (Inos), mRNA 
0   NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_206191.1  CG15669-RF, transcript variant F (MESK2), mRNA 
0   NM_206192.1  CG15669-RI, transcript variant I (MESK2), mRNA 
0   NM_206193.1  CG15669-RJ, transcript variant J (MESK2), mRNA 
0   NM_079080.2  CG15669-RD, transcript variant D (MESK2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.