National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5345R-2 
 Symbol Eip55E  Full Name Eip55E 
 CG No CG5345  Old CG No CG5345 
 Synonyms EIP40, Eip40, Eip55BD, CG5345, Eip55E 
 Accession No (Link to NCBI) NM_137508.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAGTACTCCCGCAGTGGAAA 
 Primer Seq. 3'
aatctagaggtaccCACCCATGACCACATCCGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAGTACTCC CGCAGTGGAA ATCCCACTAG GAACGTGCTG GAGACGTGCT TCgNCGCCTT 
0061 GGATAATGCC AAATACGGCC TCACGTTCTC ATCGGGATTG GGAGCCACCA CCGCTGTGCT 
0121 AACTATGCTG AGCAGCGGCG ANTCACATCA TCATGGGCGA CGATGTTTAC GGAGGCACCA 
0181 ACCGTTTGAT CCGACAgGTT GCCACCCGTC TGGGAATCTC AGCCACCTTT GTGGATCCCA 
0241 CGAAGTTGGA TCTAATTAAA AGTTCCATCA AGCCGGAGAC CAAGTTGGTG TGNGATCGAG 
0301 TCGCCAACTA ATCCATTGGT AAAGGTAGCC GACATCGAGG CTATTGCGCA GCTGGTCCAT 
0361 GGAGTACGCG AGGATATCGT CCTGGCCGTC GACAACAACC TTCCTGACCT CCTACTTCCA 
0421 GCGACCCTTG GAgCTGGGCG CTGATCTGGT CTGCTACTCC CTGACCAAGT ACATGAACGG 
0481 TCATACGGAT GTGGTCATGG GTG 
 in silico PCR Fragment
0001 TGAGTACTCC CGCAGTGGAA ATCCCACTAG GAACGTGCTG GAGACGTGCT TCGCCGCCTT 
0061 GGATAATGCC AAATACGGCC TCACGTTCTC ATCGGGATTG GGAGCCACCA CCGCTGTGCT 
0121 AACTATGCTG AGCAGCGGCG A-TCACATCA TCATGGGCGA CGATGTTTAC GGAGGCACCA 
0181 ACCGTTTGAT CCGACAGGTT GCCACCCGTC TGGGAATCTC AGCCACCTTT GTGGATCCCA 
0241 CGAAGTTGGA TCTAATTAAA AGTTCCATCA AGCCGGAGAC CAAGTTGGTG TG-GATCGAG 
0301 TCACCAACTA ATCCATTGGT AAAGGTAGCC GACATCGAGG CTATTGCGCA GCTGGTCCAT 
0361 GGAGTACGCG AGGATATCGT CCTGGCCGTC GACAAC-ACC TTCCTGACCT CCTACTTCCA 
0421 GCGACCCTTG GAGCTGGGCG CTGATCTGGT CTGCTACTCC CTGACCAAGT ACATGAACGG 
0481 TCATACGGAT GTGGTCATGG GTG 
 Assemble Data

5345R-2.IR_full       1   TGAGTACTCCCGCAGTGGAAATCCCACTAGGAACGTGCTGGAGACGTGCTTCGNCGCCTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
5345R-2.in silico     1   TGAGTACTCCCGCAGTGGAAATCCCACTAGGAACGTGCTGGAGACGTGCTTCGCCGCCTT 60


5345R-2.IR_full       61  GGATAATGCCAAATACGGCCTCACGTTCTCATCGGGATTGGGAGCCACCACCGCTGTGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5345R-2.in silico     61  GGATAATGCCAAATACGGCCTCACGTTCTCATCGGGATTGGGAGCCACCACCGCTGTGCT 120


5345R-2.IR_full       121 AACTATGCTGAGCAGCGGCGANTCACATCATCATGGGCGACGATGTTTACGGAGGCACCA 180
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
5345R-2.in silico     121 AACTATGCTGAGCAGCGGCGA-TCACATCATCATGGGCGACGATGTTTACGGAGGCACCA 180


5345R-2.IR_full       181 ACCGTTTGATCCGACAGGTTGCCACCCGTCTGGGAATCTCAGCCACCTTTGTGGATCCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5345R-2.in silico     181 ACCGTTTGATCCGACAGGTTGCCACCCGTCTGGGAATCTCAGCCACCTTTGTGGATCCCA 240


5345R-2.IR_full       241 CGAAGTTGGATCTAATTAAAAGTTCCATCAAGCCGGAGACCAAGTTGGTGTGNGATCGAG 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
5345R-2.in silico     241 CGAAGTTGGATCTAATTAAAAGTTCCATCAAGCCGGAGACCAAGTTGGTGTG-GATCGAG 300


5345R-2.IR_full       301 TCGCCAACTAATCCATTGGTAAAGGTAGCCGACATCGAGGCTATTGCGCAGCTGGTCCAT 360
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5345R-2.in silico     301 TCACCAACTAATCCATTGGTAAAGGTAGCCGACATCGAGGCTATTGCGCAGCTGGTCCAT 360


5345R-2.IR_full       361 GGAGTACGCGAGGATATCGTCCTGGCCGTCGACAACAACCTTCCTGACCTCCTACTTCCA 420
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
5345R-2.in silico     361 GGAGTACGCGAGGATATCGTCCTGGCCGTCGACAAC-ACCTTCCTGACCTCCTACTTCCA 420


5345R-2.IR_full       421 GCGACCCTTGGAGCTGGGCGCTGATCTGGTCTGCTACTCCCTGACCAAGTACATGAACGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5345R-2.in silico     421 GCGACCCTTGGAGCTGGGCGCTGATCTGGTCTGCTACTCCCTGACCAAGTACATGAACGG 480


5345R-2.IR_full       481 TCATACGGATGTGGTCATGGGTG 503
                          |||||||||||||||||||||||
5345R-2.in silico     481 TCATACGGATGTGGTCATGGGTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137508.2  CG5345-RA (Eip55E), mRNA 
0   NM_138044.2  CG13569-RA, transcript variant A (CG13569), mRNA 
0   NM_166663.1  CG13569-RB, transcript variant B (CG13569), mRNA 
0   NM_135095.1  CG14014-RA (CG14014), mRNA 
0   NM_143611.2  CG11334-RB, transcript variant B (CG11334), mRNA 
0   NM_170551.1  CG11334-RA, transcript variant A (CG11334), mRNA 
0   NM_142208.2  CG6125-RB, transcript variant B (CG6125), mRNA 
0   NM_169656.1  CG6125-RA, transcript variant A (CG6125), mRNA 
0   NM_169542.1  CG9374-RC, transcript variant C (lkb1), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 
0   NM_169546.1  CG9374-RH, transcript variant H (lkb1), mRNA 
0   NM_142045.2  CG9374-RB, transcript variant B (lkb1), mRNA 
0   NM_169543.1  CG9374-RD, transcript variant D (lkb1), mRNA 
0   NM_169544.1  CG9374-RE, transcript variant E (lkb1), mRNA 
0   NM_169541.1  CG9374-RA, transcript variant A (lkb1), mRNA 
0   NM_169547.1  CG9374-RI, transcript variant I (lkb1), mRNA 
0   NM_080140.2  CG3923-RA (Exp6), mRNA 
0   NM_079933.3  CG5408-RA (trbl), mRNA 
0   NM_134890.2  CG17265-RA (CG17265), mRNA 
0   NM_165193.1  CG17932-RB, transcript variant B (Ugt36Bc), mRNA 
0   NM_144370.2  CG17932-RA, transcript variant A (Ugt36Bc), mRNA 
0   NM_134545.2  CG15459-RA (CG15459), mRNA 
0   NM_176242.1  CG33133-RA (grau), mRNA 
0   NM_142975.2  CG5669-RA (CG5669), mRNA 
0   NM_136179.1  CG10721-RA (CG10721), mRNA 
0   NM_141304.1  CG14673-RA (CG14673), mRNA 
0   NM_137337.1  CG9640-RA (CG9640), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_132804.1  CG9203-RA (CG9203), mRNA 
0   NM_168449.1  CG32076-RA (Alg10), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.