National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5334R-3 
 Symbol CG5334  Full Name CG5334 
 CG No CG5334  Old CG No CG5334 
 Synonyms CG5334 
 Accession No (Link to NCBI) NM_132741.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTCGCTATCGATTGCGTGGA 
 Primer Seq. 3'
aatctagaggtaccAGCCCCCATTGAAGTACTTGC 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 TGTCGCTATC GATTGCGTGG AAATTGTCGT TTCGATGATT TATGCCGATA CTCACACGAT 
0061 GTGTTACAAA ATGACAACCT GAGGCCGCAG ATATCAAACA ATGCGGATGA AGTCGTGGGG 
0121 CATGCAAACA GGTACAGTCG GCCGATGACC GGGGCAAATG CAACAGAGGA GATGAAGCTA 
0181 TCCTTTGCAA TAGCCAAATC CCAGGACAAG ATGTGCGGCA TTTGTTTGGA AACCGTCGTG 
0241 AAGAAGAGGG GGCGTGAATG TCGCTTTGGC ATCCTGCCTA AGTGCAAGCA CATATTCTGT 
0301 TTGACGTGCA TTCGCAGATG GCGTCAGGCC GAGTATATCG AGGACAATGT GAAGCGTGGT 
0361 TGCCCCGAAT GTCGCGTCTT CTCGGAATTC GTGTGCCCTA GTGCCTACTG GGTGGATACA 
0421 AAGGAGGAGA AGGACAAGTT GCTAAGCGAA TATCGCGCGG CAATGGGCGC CAAGGATTGC 
0481 AAGTACTTCA ATGGGGGCT 
 in silico PCR Fragment
0001 TGTCGCTATC GATTGCGTGG AAATTGTCGT TTCGATGATT TATGCCGATA CTCACACGAT 
0061 GTGTTACAAA ATGACAACCT GAGGCCGCAG ATATCAAACA ATGCGGATGA AGTCGTGGGG 
0121 CATGCAAACA GGTACAGTCG GCCGATGACC GGGGCAAATG CAACAGAGGA GATGAAGCTA 
0181 TCCTTTGCAA TAGCCAAATC CCAGGACAAG ATGTGCGGCA TTTGTTTGGA AACCGTCGTG 
0241 AAGAAGAGGG GGCGTGAATG TCGCTTTGGC ATCCTGCCTA AGTGCAAGCA CATATTCTGT 
0301 TTGACGTGCA TTCGCAGATG GCGTCAGGCC GAGTATATCG AGGACAATGT GAAGCGTGGT 
0361 TGCCCCGAAT GTCGCGTCTT CTCGGAATTC GTGTGCCCTA GTGCCTACTG GGTGGATACA 
0421 AAGGAGGAGA AGGACAAGTT GCTAAGCGAA TATCGCGCGG CAATGGGCGC CAAGGATTGC 
0481 AAGTACTTCA ATGGGGGCT 
 Assemble Data

5334R-3.IR_full       1   TGTCGCTATCGATTGCGTGGAAATTGTCGTTTCGATGATTTATGCCGATACTCACACGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     1   TGTCGCTATCGATTGCGTGGAAATTGTCGTTTCGATGATTTATGCCGATACTCACACGAT 60


5334R-3.IR_full       61  GTGTTACAAAATGACAACCTGAGGCCGCAGATATCAAACAATGCGGATGAAGTCGTGGGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     61  GTGTTACAAAATGACAACCTGAGGCCGCAGATATCAAACAATGCGGATGAAGTCGTGGGG 120


5334R-3.IR_full       121 CATGCAAACAGGTACAGTCGGCCGATGACCGGGGCAAATGCAACAGAGGAGATGAAGCTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     121 CATGCAAACAGGTACAGTCGGCCGATGACCGGGGCAAATGCAACAGAGGAGATGAAGCTA 180


5334R-3.IR_full       181 TCCTTTGCAATAGCCAAATCCCAGGACAAGATGTGCGGCATTTGTTTGGAAACCGTCGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     181 TCCTTTGCAATAGCCAAATCCCAGGACAAGATGTGCGGCATTTGTTTGGAAACCGTCGTG 240


5334R-3.IR_full       241 AAGAAGAGGGGGCGTGAATGTCGCTTTGGCATCCTGCCTAAGTGCAAGCACATATTCTGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     241 AAGAAGAGGGGGCGTGAATGTCGCTTTGGCATCCTGCCTAAGTGCAAGCACATATTCTGT 300


5334R-3.IR_full       301 TTGACGTGCATTCGCAGATGGCGTCAGGCCGAGTATATCGAGGACAATGTGAAGCGTGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     301 TTGACGTGCATTCGCAGATGGCGTCAGGCCGAGTATATCGAGGACAATGTGAAGCGTGGT 360


5334R-3.IR_full       361 TGCCCCGAATGTCGCGTCTTCTCGGAATTCGTGTGCCCTAGTGCCTACTGGGTGGATACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     361 TGCCCCGAATGTCGCGTCTTCTCGGAATTCGTGTGCCCTAGTGCCTACTGGGTGGATACA 420


5334R-3.IR_full       421 AAGGAGGAGAAGGACAAGTTGCTAAGCGAATATCGCGCGGCAATGGGCGCCAAGGATTGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5334R-3.in silico     421 AAGGAGGAGAAGGACAAGTTGCTAAGCGAATATCGCGCGGCAATGGGCGCCAAGGATTGC 480


5334R-3.IR_full       481 AAGTACTTCAATGGGGGCT 499
                          |||||||||||||||||||
5334R-3.in silico     481 AAGTACTTCAATGGGGGCT 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_132741.1  CG5334-RA (CG5334), mRNA 
28.06   135  56  94  83  NM_132742.1  CG5347-RA (CG5347), mRNA 
0   12  35  53  NM_079965.2  CG7184-RA, transcript variant A (Mkrn1), mRNA 
0   12  35  53  NM_168922.1  CG7184-RB, transcript variant B (Mkrn1), mRNA 
0   12  13  34  NM_140798.1  CG12477-RA (CG12477), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_139921.2  CG7972-RA (mus301), mRNA 
0   NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0   NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0   NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0   NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0   NM_138229.1  CG13908-RA (CG13908), mRNA 
0   NM_131923.2  CG6121-RA (Tip60), mRNA 
0   NM_167319.3  CG32656-RA (CG32656), mRNA 
0   NM_167364.1  CG15747-RA (CG15747), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 
0   NM_141579.2  CG9839-RA (CG9839), mRNA 
0   12  NM_206565.1  CG6695-RB, transcript variant B (CG6695), mRNA 
0   12  NM_143019.2  CG6695-RA, transcript variant A (CG6695), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_135652.2  CG6287-RA (CG6287), mRNA 
0   NM_143638.2  CG2126-RA (CG2126), mRNA 
0   NM_137530.1  CG15080-RA (CG15080), mRNA 
0   NM_139644.1  CG15020-RA (CG15020), mRNA 
0   NM_143524.2  CG9743-RA (CG9743), mRNA 
0   12  NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   12  NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.