National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5334R-1 
 Symbol CG5334  Full Name CG5334 
 CG No CG5334  Old CG No CG5334 
 Synonyms CG5334 
 Accession No (Link to NCBI) NM_132741.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTCGCTATCGATTGCGTGGAAATTGTCGTTTCGATGATTTATGCCGATACTCACACGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGTTACAAAATGACAACCTGAGGCCGCAGATATCAAACAATGCGGATGAAGTCGTGGGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CATGCAAACAGGTACAGTCGGCCGATGACCGGGGCAAATGCAACAGAGGAGATGAAGCTA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCTTTGCAATAGCCAAATCCCAGGACAAGATGTGCGGCATTTGTTTGGAAACCGTCGTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGAAGAGGGGGCGTGAATGTCGCTTTGGCATCCTGCCTAAGTGCAAGCACATATTCTGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGACGTGCATTCGCAGATGGCGTCAGGCCGAGTATATCGAGGACAATGTGAAGCGTGGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCCCCGAATGTCGCGTCTTCTCGGAATTCGTGTGCCCTAGTGCCTACTGGGTGGATACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGGAGGAGAAGGACAAGTTGCTAAGCGAATATCGCGCGGCAATGGGCGCCAAGGATTGC 480

5334R-1.IR_full       481 AAGTACTTCAATGGGGGCT 499
                          ||||||||||||||||||| silico     481 AAGTACTTCAATGGGGGCT 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_132741.1  CG5334-RA (CG5334), mRNA 
28.06   135  56  94  83  NM_132742.1  CG5347-RA (CG5347), mRNA 
0   12  35  53  NM_079965.2  CG7184-RA, transcript variant A (Mkrn1), mRNA 
0   12  35  53  NM_168922.1  CG7184-RB, transcript variant B (Mkrn1), mRNA 
0   12  13  34  NM_140798.1  CG12477-RA (CG12477), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_139921.2  CG7972-RA (mus301), mRNA 
0   NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0   NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0   NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0   NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0   NM_138229.1  CG13908-RA (CG13908), mRNA 
0   NM_131923.2  CG6121-RA (Tip60), mRNA 
0   NM_167319.3  CG32656-RA (CG32656), mRNA 
0   NM_167364.1  CG15747-RA (CG15747), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 
0   NM_141579.2  CG9839-RA (CG9839), mRNA 
0   12  NM_206565.1  CG6695-RB, transcript variant B (CG6695), mRNA 
0   12  NM_143019.2  CG6695-RA, transcript variant A (CG6695), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_135652.2  CG6287-RA (CG6287), mRNA 
0   NM_143638.2  CG2126-RA (CG2126), mRNA 
0   NM_137530.1  CG15080-RA (CG15080), mRNA 
0   NM_139644.1  CG15020-RA (CG15020), mRNA 
0   NM_143524.2  CG9743-RA (CG9743), mRNA 
0   12  NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   12  NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.