National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5323R-3 
 Symbol CG5323  Full Name CG5323 
 CG No CG5323  Old CG No CG5323 
 Synonyms CG5323 
 Accession No (Link to NCBI) NM_137502.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGATCCAGCAACAGCGCCAGAAAATCGAGGCCGCGGTAACGGAGATGATCGACGACATG 60

                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACAA-GACGCACCTGCGCAAAATGCAGAATGAGATGCACTTGTGTGCGGCCAAGTGCTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAGGATGGAACCTCCAGCGTGGACAGTGTCCAGAGATGTGTGGATCGATGCTCCGCGCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATGACGAGGGCACAGAACTACGTTCAACACGAATTGGGCGAGTTCCAGGGCAGACTTCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACGTTGCGTCATGCAATGCAACGACGATGTGAAGGTGAAAATGCCGCCCAGTCCCAATGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGATCAGATAGCCAAGTACACCGACCAATTCGAGCGCTGTGCCATCCAGTGTGTGGACAA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCATGTGGGCCTCATTCCCGGCATGATGAAGACCATGAAGGCTGTGCTCTCCAAGGGACC 420

5323R-3.IR_full       421 CGAGAGCATTCCCCAAGTC 439
                          ||||||||||||||||||| silico     421 CGAGAGCATTCCCCAAGTC 439

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   420  NM_137502.3  CG5323-RA (CG5323), mRNA 
0.47   NM_143283.1  CG5882-RA (CG5882), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_170360.1  CG4976-RA (Mes-4), mRNA 
0   NM_206662.1  CG12065-RC, transcript variant C (CG12065), mRNA 
0   NM_132265.2  CG12065-RA, transcript variant A (CG12065), mRNA 
0   NM_137865.1  CG13518-RA (Obp58b), mRNA 
0   NM_141805.1  CG5207-RA (scpr-A), mRNA 
0   NM_078878.2  CG10123-RA (Top3alpha), mRNA 
0   NM_136131.2  CG10189-RA (CG10189), mRNA 
0   NM_142486.2  CG7708-RA, transcript variant A (CG7708), mRNA 
0   NM_169832.1  CG7708-RB, transcript variant B (CG7708), mRNA 
0   NM_134820.2  CG10882-RA (CG10882), mRNA 
0   NM_001043138.1  CG17672-RA (CG17672), mRNA 
0   NM_134708.2  CG13949-RA (CG13949), mRNA 
0   10  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   10  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_170478.1  CG15532-RB, transcript variant B (hdc), mRNA 
0   NM_169964.1  CG31343-RA (CG31343), mRNA 
0   NM_135169.2  CG9493-RA (Pez), mRNA 
0   NM_080531.2  CG5481-RA (lea), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_143138.1  CG5127-RA (CG5127), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_164736.1  CG13777-RA, transcript variant A (milt), mRNA 
0   NM_164674.1  CG31643-RA (CG31643), mRNA 
0   NM_141895.2  CG14740-RA (CG14740), mRNA 
0   NM_137817.2  CG3413-RB, transcript variant B (wdp), mRNA 
0   NM_166526.1  CG3413-RD, transcript variant D (wdp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.